Genetic Distance (cM) Physical Distance (bp) LOD score Chr Start End Ref Alt MutType Func.Sum cDNA_change AA_change AA_property_before_change AA_property_after_change Human_symbol Mouse_symbol Ensemble ID Approved Name Genomic Coordinate Function Description Human Disease KO Mouse Phenotype Pathway Biological Process Cellular Component Molecular Function GeneCards UniprotKB HPO OMIM MGI PubMed avsnp147 1000g_MAF esp6500_MAF exac03_MAF noxious_ratio pred_noxious pred_covered Func.refGene Func.knownGene Func.ensGene Gene.refGene Gene.knownGene Gene.ensGene ExonicFunc.refGene ExonicFunc.knownGene ExonicFunc.ensGene AAChange.refGene AAChange.knownGene AAChange.ensGene 302_Male_Control Quality;R|A_302_Male_Control 401_Male_Control Quality;R|A_401_Male_Control 402_Male_Patient Quality;R|A_402_Male_Patient 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 12315186 12315186 G A snp nonsynonymous SNV G208A V70I aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral MICALCL Micalcl ENSG00000133808 MICAL C-terminal like chr11:12297627-12380691 Tobacco Use Disorder; Electrocardiography; Alcoholism GO:0007275;multicellular organism development;IEA|GO:0007283;spermatogenesis;IEA|GO:0008150;biological_process;ND|GO:0030154;cell differentiation;IEA GO:0005737;cytoplasm;IEA GO:0051019;mitogen-activated protein kinase binding;ISS http://www.genecards.org/index.php?path=/Search/keyword/MICALCL https://www.uniprot.org/uniprot/Q6ZW33 https://www.ncbi.nlm.nih.gov/omim/?term=612355 http://www.informatics.jax.org/searchtool/Search.do?query=MICALCL&submit=Quick%0D%6873ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MICALCL rs10741578 0.533746 0.4243 0.4419 0.08 1 13 exonic exonic exonic MICALCL MICALCL ENSG00000133808 nonsynonymous SNV nonsynonymous SNV unknown MICALCL:NM_032867:exon3:c.G208A:p.V70I, MICALCL:uc001mkg.1:exon3:c.G208A:p.V70I, UNKNOWN Het;G>A 1845;91|81 Het;G>A 1541;83|76 Hom;G>A 4723;0|175 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 12315915 12315915 A G snp nonsynonymous SNV A937G S313G polar,hydrophilic,neutral aliphatic,neutral MICALCL Micalcl ENSG00000133808 MICAL C-terminal like chr11:12297627-12380691 Tobacco Use Disorder; Electrocardiography; Alcoholism GO:0007275;multicellular organism development;IEA|GO:0007283;spermatogenesis;IEA|GO:0008150;biological_process;ND|GO:0030154;cell differentiation;IEA GO:0005737;cytoplasm;IEA GO:0051019;mitogen-activated protein kinase binding;ISS http://www.genecards.org/index.php?path=/Search/keyword/MICALCL https://www.uniprot.org/uniprot/Q6ZW33 https://www.ncbi.nlm.nih.gov/omim/?term=612355 http://www.informatics.jax.org/searchtool/Search.do?query=MICALCL&submit=Quick%0D%6873ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MICALCL rs1493954 0.53095 0.4030 0.4160 0.38 5 13 exonic exonic exonic MICALCL MICALCL ENSG00000133808 nonsynonymous SNV nonsynonymous SNV unknown MICALCL:NM_032867:exon3:c.A937G:p.S313G, MICALCL:uc001mkg.1:exon3:c.A937G:p.S313G, UNKNOWN Het;A>G 2130;96|89 Het;A>G 1517;105|69 Hom;A>G 4194;0|136 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 12316344 12316344 G GCTC indel nonframeshift substitution 1366_1366delinsGCTC MICALCL Micalcl ENSG00000133808 MICAL C-terminal like chr11:12297627-12380691 Tobacco Use Disorder; Electrocardiography; Alcoholism GO:0007275;multicellular organism development;IEA|GO:0007283;spermatogenesis;IEA|GO:0008150;biological_process;ND|GO:0030154;cell differentiation;IEA GO:0005737;cytoplasm;IEA GO:0051019;mitogen-activated protein kinase binding;ISS http://www.genecards.org/index.php?path=/Search/keyword/MICALCL https://www.uniprot.org/uniprot/Q6ZW33 https://www.ncbi.nlm.nih.gov/omim/?term=612355 http://www.informatics.jax.org/searchtool/Search.do?query=MICALCL&submit=Quick%0D%6873ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MICALCL rs767104379 0 0.1585 0.0034 1 0 0 exonic exonic exonic MICALCL MICALCL ENSG00000133808 nonframeshift substitution nonframeshift substitution unknown MICALCL:NM_032867:exon3:c.1366_1366delinsGCTC, MICALCL:uc001mkg.1:exon3:c.1366_1366delinsGCTC, UNKNOWN Het;+CTC 263;11|9 Het;+CTC 131;15|6 Hom;+CTC 607;2|16 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17352477 17352480 TACA T indel nonframeshift substitution 1202_1205T NUCB2 Nucb2 ENSG00000070081 nucleobindin 2 chr11:17229700-17371521 This gene encodes a protein with a suggested role in calcium level maintenance, eating regulation in the hypothalamus, and release of tumor necrosis factor from vascular endothelial cells. This protein binds calcium and has EF-folding domains. [provided by RefSeq, Oct 2011] Type 2 Diabetes| edema | rosiglitazone; Chronic renal failure|Kidney Failure, Chronic Homozygous mutation of this gene results in decreased heart rate and increased serum alkaline phosphatase levels. GO:0005634;nucleus;IEA|GO:0005640;nuclear outer membrane;IEA|GO:0005737;cytoplasm;IEA|GO:0005783;endoplasmic reticulum;IEA GO:0005509;calcium ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/NUCB2 https://www.uniprot.org/uniprot/A0A087WSV8 https://www.ncbi.nlm.nih.gov/omim/?term=608020 http://www.informatics.jax.org/searchtool/Search.do?query=NUCB2&submit=Quick%0D%1342ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=NUCB2 rs3842269 0.253594 0.2299 0.2574 1 0 0 exonic exonic exonic NUCB2 NUCB2 ENSG00000070081 nonframeshift substitution nonframeshift substitution unknown NUCB2:NM_005013:exon13:c.1202_1205T, NUCB2:uc009ygz.3:exon10:c.1112_1115T,NUCB2:uc001mmw.3:exon13:c.1202_1205T, UNKNOWN Het;-ACA 1297;45|35 Het;-ACA 1357;25|35 Hom;-ACA 2708;0|61 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17408630 17408630 C T snp nonsynonymous SNV G1009A V337I aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral KCNJ11 Kcnj11 ENSG00000187486 potassium voltage-gated channel subfamily J member 11 chr11:17407406-17410878 Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009] type 2 diabetes; Diabetes mellitus type II|Diabetes Mellitus, Type 2|Glucose Metabolism Disorders; Hyperinsulinism|Hypoglycemia|Persistent Hyperinsulinemia Hypoglycemia of Infancy; sulfonylurea failure, secondary; Diabetes Mellitus|Diabetes Mellitus, Type 2|; myocardial infarct; coronary heart disease; diabetes, type 2 insulin; Diabetes mellitus|HIV Infections|[X]Human immunodeficiency virus disease; glucose tolerance; diabetes, type 1; Alzheimer's disease ; diabetes, type 1 ; blood pressure, arterial hypertension; insulin; glucose; diabetes, type 2; insulin; Diabetes Mellitus; Diabetes mellitus|Diabetes mellitus type II|Diabetes Mellitus, Type 2; diabetes, type 2; Diabetes Mellitus, Type 2; Calcium; Type 2 diabetes|reduced prostate cancer risk; Type 2 diabetes; Coronary Disease; Kidney Failure, Chronic; atherosclerosis; Persistent Hyperinsulinemia Hypoglycemia of Infancy; impaired glucagon suppression; null; obesity|BMI; Calcinosis|Coronary Artery Disease|Diabetes mellitus; impaired exercise stress response; Diabetes Mellitus|; glucose homeostasis; diabetes; diabetes, gestational; Diabetes Mellitus, Type 2|Polycystic Ovary Syndrome; Type 2 Diabetes| edema | rosiglitazone; Diabetes mellitus type II|Diabetes Mellitus, Type 2; Insulin Resistance; insulin release and insulin sensitivity; Diabetes Mellitus, Type 1; diabetes, type 2 hypertension; familial hyperinsulinism.; hypoglycemia awareness; Hypertension|Ventricular Remodeling; diabetes, type 2; diabetes, type 1; hyperglycemia; androgen polycystic ovary syndrome; obesity; diabetes, type 2 | diabetes, type 1; metabolic syndrome; Diabetes Mellitus, Type 2|Fetal Diseases|Malnutrition|Starvation Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. Defective ABCC8 can cause hypoglycemias and hyperglycemias GO:0002931;response to ischemia;IEA|GO:0006006;glucose metabolic process;IMP|GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0010107;potassium ion import;IBA|GO:0032355;response to estradiol;IEA|GO:0033198;response to ATP;IDA|GO:0033574;response to testosterone;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0042391;regulation of membrane potential;IDA|GO:0042493;response to drug;IMP|GO:0046676;negative regulation of insulin secretion;IMP|GO:0050796;regulation of insulin secretion;TAS|GO:0050877;neurological system process;IMP|GO:0055085;transmembrane transport;TAS|GO:0071316;cellular response to nicotine;IEA|GO:0071333;cellular response to glucose stimulus;IEA|GO:0071356;cellular response to tumor necrosis factor;IEA|GO:0071805;potassium ion transmembrane transport;IDA|GO:0098655;cation transmembrane transport;IEA|GO:1903779;regulation of cardiac conduction;TAS|GO:1905965;positive regulation of protein targeting to plasma membrane;IEA|GO:2001259;positive regulation of cation channel activity;IEA GO:0001669;acrosomal vesicle;IEA|GO:0005635;nuclear envelope;IEA|GO:0005739;mitochondrion;IEA|GO:0005768;endosome;IEA|GO:0005783;endoplasmic reticulum;IEA|GO:0005829;cytosol;IEA|GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0008076;voltage-gated potassium channel complex;IDA|GO:0008282;ATP-sensitive potassium channel complex;IDA|GO:0014704;intercalated disc;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0030315;T-tubule;ISS|GO:0030673;axolemma;IEA|GO:0042383;sarcolemma;IEA|GO:0043025;neuronal cell body;IEA|GO:0043209;myelin sheath;IEA|GO:0043231;intracellular membrane-bounded organelle;IEA|GO:0070852;cell body fiber;IEA GO:0005242;inward rectifier potassium channel activity;IEA|GO:0005244;voltage-gated ion channel activity;IEA|GO:0005249;voltage-gated potassium channel activity;IDA|GO:0005524;ATP binding;TAS|GO:0008022;protein C-terminus binding;IEA|GO:0015272;ATP-activated inward rectifier potassium channel activity;IBA|GO:0030506;ankyrin binding;IPI|GO:0030955;potassium ion binding;TAS|GO:0031072;heat shock protein binding;IEA|GO:0044325;ion channel binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/KCNJ11 https://hpo.jax.org/app/browse/search?q=KCNJ11&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=600937 http://www.informatics.jax.org/searchtool/Search.do?query=KCNJ11&submit=Quick%0D%15827ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNJ11 rs5215 0.730631 0.7320 0.6448 0.25 3 12 exonic exonic exonic KCNJ11 KCNJ11 ENSG00000187486 nonsynonymous SNV nonsynonymous SNV unknown KCNJ11:NM_001166290:exon2:c.G748A:p.V250I,KCNJ11:NM_000525:exon1:c.G1009A:p.V337I, KCNJ11:uc001mna.3:exon1:c.G1009A:p.V337I,KCNJ11:uc001mnb.4:exon2:c.G748A:p.V250I, UNKNOWN Het;C>T 2522;92|110 Het;C>T 2055;97|89 Hom;C>T 4462;0|157 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17409572 17409572 T C snp nonsynonymous SNV A67G K23E polar,hydrophilic,charged(+) polar,hydrophilic,charged(-) KCNJ11 Kcnj11 ENSG00000187486 potassium voltage-gated channel subfamily J member 11 chr11:17407406-17410878 Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009] type 2 diabetes; Diabetes mellitus type II|Diabetes Mellitus, Type 2|Glucose Metabolism Disorders; Hyperinsulinism|Hypoglycemia|Persistent Hyperinsulinemia Hypoglycemia of Infancy; sulfonylurea failure, secondary; Diabetes Mellitus|Diabetes Mellitus, Type 2|; myocardial infarct; coronary heart disease; diabetes, type 2 insulin; Diabetes mellitus|HIV Infections|[X]Human immunodeficiency virus disease; glucose tolerance; diabetes, type 1; Alzheimer's disease ; diabetes, type 1 ; blood pressure, arterial hypertension; insulin; glucose; diabetes, type 2; insulin; Diabetes Mellitus; Diabetes mellitus|Diabetes mellitus type II|Diabetes Mellitus, Type 2; diabetes, type 2; Diabetes Mellitus, Type 2; Calcium; Type 2 diabetes|reduced prostate cancer risk; Type 2 diabetes; Coronary Disease; Kidney Failure, Chronic; atherosclerosis; Persistent Hyperinsulinemia Hypoglycemia of Infancy; impaired glucagon suppression; null; obesity|BMI; Calcinosis|Coronary Artery Disease|Diabetes mellitus; impaired exercise stress response; Diabetes Mellitus|; glucose homeostasis; diabetes; diabetes, gestational; Diabetes Mellitus, Type 2|Polycystic Ovary Syndrome; Type 2 Diabetes| edema | rosiglitazone; Diabetes mellitus type II|Diabetes Mellitus, Type 2; Insulin Resistance; insulin release and insulin sensitivity; Diabetes Mellitus, Type 1; diabetes, type 2 hypertension; familial hyperinsulinism.; hypoglycemia awareness; Hypertension|Ventricular Remodeling; diabetes, type 2; diabetes, type 1; hyperglycemia; androgen polycystic ovary syndrome; obesity; diabetes, type 2 | diabetes, type 1; metabolic syndrome; Diabetes Mellitus, Type 2|Fetal Diseases|Malnutrition|Starvation Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. Defective ABCC8 can cause hypoglycemias and hyperglycemias GO:0002931;response to ischemia;IEA|GO:0006006;glucose metabolic process;IMP|GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0010107;potassium ion import;IBA|GO:0032355;response to estradiol;IEA|GO:0033198;response to ATP;IDA|GO:0033574;response to testosterone;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0042391;regulation of membrane potential;IDA|GO:0042493;response to drug;IMP|GO:0046676;negative regulation of insulin secretion;IMP|GO:0050796;regulation of insulin secretion;TAS|GO:0050877;neurological system process;IMP|GO:0055085;transmembrane transport;TAS|GO:0071316;cellular response to nicotine;IEA|GO:0071333;cellular response to glucose stimulus;IEA|GO:0071356;cellular response to tumor necrosis factor;IEA|GO:0071805;potassium ion transmembrane transport;IDA|GO:0098655;cation transmembrane transport;IEA|GO:1903779;regulation of cardiac conduction;TAS|GO:1905965;positive regulation of protein targeting to plasma membrane;IEA|GO:2001259;positive regulation of cation channel activity;IEA GO:0001669;acrosomal vesicle;IEA|GO:0005635;nuclear envelope;IEA|GO:0005739;mitochondrion;IEA|GO:0005768;endosome;IEA|GO:0005783;endoplasmic reticulum;IEA|GO:0005829;cytosol;IEA|GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0008076;voltage-gated potassium channel complex;IDA|GO:0008282;ATP-sensitive potassium channel complex;IDA|GO:0014704;intercalated disc;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0030315;T-tubule;ISS|GO:0030673;axolemma;IEA|GO:0042383;sarcolemma;IEA|GO:0043025;neuronal cell body;IEA|GO:0043209;myelin sheath;IEA|GO:0043231;intracellular membrane-bounded organelle;IEA|GO:0070852;cell body fiber;IEA GO:0005242;inward rectifier potassium channel activity;IEA|GO:0005244;voltage-gated ion channel activity;IEA|GO:0005249;voltage-gated potassium channel activity;IDA|GO:0005524;ATP binding;TAS|GO:0008022;protein C-terminus binding;IEA|GO:0015272;ATP-activated inward rectifier potassium channel activity;IBA|GO:0030506;ankyrin binding;IPI|GO:0030955;potassium ion binding;TAS|GO:0031072;heat shock protein binding;IEA|GO:0044325;ion channel binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/KCNJ11 https://hpo.jax.org/app/browse/search?q=KCNJ11&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=600937 http://www.informatics.jax.org/searchtool/Search.do?query=KCNJ11&submit=Quick%0D%15827ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNJ11 rs5219 0.737021 0.7381 0.6471 0.25 3 12 exonic exonic exonic KCNJ11 KCNJ11 ENSG00000187486 nonsynonymous SNV nonsynonymous SNV unknown KCNJ11:NM_000525:exon1:c.A67G:p.K23E, KCNJ11:uc001mna.3:exon1:c.A67G:p.K23E, UNKNOWN Het;T>C 1928;118|88 Het;T>C 2211;89|100 Hom;T>C 4670;1|174 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17418477 17418477 C A snp nonsynonymous SNV G4105T A1369S aliphatic,hydrophobic,neutral polar,hydrophilic,neutral ABCC8 Abcc8 ENSG00000006071 ATP binding cassette subfamily C member 8 chr11:17414432-17498449 The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013] Hyperinsulinism|Hypoglycemia|Persistent Hyperinsulinemia Hypoglycemia of Infancy; BMI- Edema rosiglitazone or pioglitazone; hyperglycemia insulin; diabetes, gestational; Albumins; beta-cell function body mass cholesterol, HDL diabetic complications stroke; Diabetes Mellitus; Diabetes Mellitus, Type 2; Diabetes mellitus type II|Diabetes Mellitus, Type 2|Glucose Metabolism Disorders; Type 2 Diabetes| edema | rosiglitazone; Hypercholesterolemia|LDLC levels; Kidney Failure, Chronic; esophageal adenocarcinoma; glucose tolerance; Diabetes Mellitus, Type 1; sulfonylurea or insulin treatment; high insulin concentrations in non-diabetic Mexican Ameri; Diabetes Mellitus, Type 2|Hypoglycemia; Persistent Hyperinsulinemia Hypoglycemia of Infancy; Insulin Resistance; metabolic syndrome; Obesity|POF - Premature ovarian failure|POLYCYSTIC OVARIAN SYNDROME|Polycystic Ovary Syndrome|Primary Ovarian Insufficiency|Puberty, Delayed|Puberty, Precocious|Thrombophilia|Tobacco Use Disorder; diabetes, type 2 insulin; Alzheimer's disease ; insulin; diabetes, type 2; drug-related genes ; Diabetes mellitus|Diabetes mellitus type II|Diabetes Mellitus, Type 2; diabetes, type 2; beta-cell function; Type 2 diabetes Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. Defective ABCC8 can cause hypoglycemias and hyperglycemias GO:0001678;cellular glucose homeostasis;IEA|GO:0006810;transport;IEA|GO:0006813;potassium ion transport;TAS|GO:0007165;signal transduction;IEA|GO:0007565;female pregnancy;IEA|GO:0009268;response to pH;IEA|GO:0010043;response to zinc ion;IEA|GO:0010989;negative regulation of low-density lipoprotein particle clearance;IEA|GO:0032496;response to lipopolysaccharide;IEA|GO:0032868;response to insulin;IEA|GO:0042493;response to drug;IBA|GO:0043268;positive regulation of potassium ion transport;IEA|GO:0046676;negative regulation of insulin secretion;IEA|GO:0050768;negative regulation of neurogenesis;IEA|GO:0050796;regulation of insulin secretion;TAS|GO:0055085;transmembrane transport;TAS|GO:0060253;negative regulation of glial cell proliferation;IEA|GO:0061855;negative regulation of neuroblast migration;IEA|GO:0071310;cellular response to organic substance;IEA|GO:0071805;potassium ion transmembrane transport;IEA|GO:0098655;cation transmembrane transport;IEA|GO:0099133;ATP hydrolysis coupled anion transmembrane transport;IEA|GO:1900721;positive regulation of uterine smooth muscle relaxation;IEA|GO:1903818;positive regulation of voltage-gated potassium channel activity;IEA|GO:1904469;positive regulation of tumor necrosis factor secretion;IEA|GO:1905605;positive regulation of maintenance of permeability of blood-brain barrier;IEA GO:0005739;mitochondrion;IEA|GO:0005886;plasma membrane;TAS|GO:0008076;voltage-gated potassium channel complex;IDA|GO:0008282;ATP-sensitive potassium channel complex;IBA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0030672;synaptic vesicle membrane;IEA|GO:0042383;sarcolemma;IBA GO:0000166;nucleotide binding;IEA|GO:0005267;potassium channel activity;IMP|GO:0005524;ATP binding;IEA|GO:0008281;sulfonylurea receptor activity;IEA|GO:0015272;ATP-activated inward rectifier potassium channel activity;TAS|GO:0016887;ATPase activity;IEA|GO:0019905;syntaxin binding;IEA|GO:0042626;ATPase activity, coupled to transmembrane movement of substances;IBA|GO:0043225;ATPase-coupled anion transmembrane transporter activity;TAS|GO:0044325;ion channel binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/ABCC8 https://www.uniprot.org/uniprot/Q09428 https://hpo.jax.org/app/browse/search?q=ABCC8&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=600509 http://www.informatics.jax.org/searchtool/Search.do?query=ABCC8&submit=Quick%0D%388ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ABCC8 rs757110 0.726438 0.7386 0.6431 0.15 2 13 exonic exonic exonic ABCC8 ABCC8 ENSG00000006071 nonsynonymous SNV nonsynonymous SNV unknown ABCC8:NM_000352:exon33:c.G4105T:p.A1369S,ABCC8:NM_001287174:exon33:c.G4108T:p.A1370S, ABCC8:uc001mnc.3:exon33:c.G4105T:p.A1369S, UNKNOWN Het;C>A 1492;88|66 Het;C>A 1828;66|85 Hom;C>A 3559;0|129 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17580175 17580175 A T snp nonsynonymous SNV A1123T T375S polar,hydrophilic,neutral polar,hydrophilic,neutral OTOG Otog ENSG00000188162 otogelin chr11:17568920-17668697 The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014] Stroke; Parkinson Disease; Hemoglobins Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. GO:0007605;sensory perception of sound;IEA|GO:0008344;adult locomotory behavior;IEA|GO:0046373;L-arabinose metabolic process;IEA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005886;plasma membrane;IEA|GO:0016020;membrane;IEA|GO:0016324;apical plasma membrane;IEA GO:0005198;structural molecule activity;IEA|GO:0046556;alpha-L-arabinofuranosidase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/OTOG https://hpo.jax.org/app/browse/search?q=OTOG&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=604487 http://www.informatics.jax.org/searchtool/Search.do?query=OTOG&submit=Quick%0D%15978ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OTOG rs7130190 0.086262 0 0.1203 0.30 3 10 exonic exonic exonic OTOG OTOG ENSG00000188162 nonsynonymous SNV nonsynonymous SNV unknown OTOG:NM_001277269:exon9:c.A1123T:p.T375S,OTOG:NM_001292063:exon10:c.A1087T:p.T363S, OTOG:uc031pzc.1:exon9:c.A1123T:p.T375S, UNKNOWN Het;A>T 1826;100|87 Het;A>T 1506;58|71 Hom;A>T 2895;1|110 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17632306 17632306 C T snp nonsynonymous SNV C5495T A1832V aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral OTOG Otog ENSG00000188162 otogelin chr11:17568920-17668697 The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014] Stroke; Parkinson Disease; Hemoglobins Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. GO:0007605;sensory perception of sound;IEA|GO:0008344;adult locomotory behavior;IEA|GO:0046373;L-arabinose metabolic process;IEA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005886;plasma membrane;IEA|GO:0016020;membrane;IEA|GO:0016324;apical plasma membrane;IEA GO:0005198;structural molecule activity;IEA|GO:0046556;alpha-L-arabinofuranosidase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/OTOG https://hpo.jax.org/app/browse/search?q=OTOG&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=604487 http://www.informatics.jax.org/searchtool/Search.do?query=OTOG&submit=Quick%0D%15978ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OTOG rs1003490 0.0978435 0 0.1234 0.54 7 13 exonic exonic exonic OTOG OTOG ENSG00000188162 nonsynonymous SNV nonsynonymous SNV unknown OTOG:NM_001277269:exon35:c.C5495T:p.A1832V,OTOG:NM_001292063:exon36:c.C5459T:p.A1820V, OTOG:uc031pzc.1:exon35:c.C5495T:p.A1832V,OTOG:uc001mnh.1:exon12:c.C2513T:p.A838V, UNKNOWN Het;C>T 4082;189|179 Het;C>T 2887;125|131 Hom;C>T 7046;6|264 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 17663416 17663416 G A snp nonsynonymous SNV G8249A R2750Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral OTOG Otog ENSG00000188162 otogelin chr11:17568920-17668697 The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014] Stroke; Parkinson Disease; Hemoglobins Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. GO:0007605;sensory perception of sound;IEA|GO:0008344;adult locomotory behavior;IEA|GO:0046373;L-arabinose metabolic process;IEA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005886;plasma membrane;IEA|GO:0016020;membrane;IEA|GO:0016324;apical plasma membrane;IEA GO:0005198;structural molecule activity;IEA|GO:0046556;alpha-L-arabinofuranosidase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/OTOG https://hpo.jax.org/app/browse/search?q=OTOG&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=604487 http://www.informatics.jax.org/searchtool/Search.do?query=OTOG&submit=Quick%0D%15978ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OTOG rs12422210 0.0828674 0 0.1576 0.10 1 10 exonic exonic exonic OTOG OTOG ENSG00000188162 nonsynonymous SNV nonsynonymous SNV unknown OTOG:NM_001277269:exon51:c.G8249A:p.R2750Q,OTOG:NM_001292063:exon52:c.G8213A:p.R2738Q, OTOG:uc031pzc.1:exon51:c.G8249A:p.R2750Q, UNKNOWN Het;G>A 2473;94|106 Het;G>A 1258;62|64 Hom;G>A 3085;0|111 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 18159254 18159254 A G snp nonsynonymous SNV A505G N169D polar,hydrophilic,neutral polar,hydrophilic,charged(-) MRGPRX3 Mrgpra9 ENSG00000179826 MAS related GPR family member X3 chr11:18142502-18160027 This gene encodes a member of the mas-related/sensory neuron specific subfamily of G protein coupled receptors. The encoded protein may be involved in sensory neuron regulation and in the modulation of pain. [provided by RefSeq, Oct 2009] GO:0007165;signal transduction;IEA|GO:0007186;G-protein coupled receptor signaling pathway;IEA GO:0005886;plasma membrane;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0004871;signal transducer activity;IEA|GO:0004930;G-protein coupled receptor activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/MRGPRX3 https://www.ncbi.nlm.nih.gov/omim/?term=607229 http://www.informatics.jax.org/searchtool/Search.do?query=MRGPRX3&submit=Quick%0D%14387ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MRGPRX3 rs4274188 0.743011 0.7042 0.7697 0.08 1 13 exonic exonic exonic MRGPRX3 MRGPRX3 ENSG00000179826 nonsynonymous SNV nonsynonymous SNV unknown MRGPRX3:NM_054031:exon3:c.A505G:p.N169D, MRGPRX3:uc021qek.1:exon1:c.A505G:p.N169D,MRGPRX3:uc001mnu.3:exon3:c.A505G:p.N169D, UNKNOWN Het;A>G 2833;112|117 Het;A>G 2314;98|98 Hom;A>G 6042;0|207 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 18735947 18735947 T C snp nonsynonymous SNV A1675G M559V hydrophobic,neutral aliphatic,hydrophobic,neutral IGSF22 ENSG00000179057 immunoglobulin superfamily member 22 chr11:18725852-18747777 GO:0006941;striated muscle contraction;IBA|GO:0007015;actin filament organization;IBA|GO:0045214;sarcomere organization;IBA|GO:0071688;striated muscle myosin thick filament assembly;IBA GO:0005859;muscle myosin complex;IBA|GO:0030018;Z disc;IBA|GO:0031430;M band;IBA GO:0008307;structural constituent of muscle;IBA|GO:0051015;actin filament binding;IBA|GO:0051371;muscle alpha-actinin binding;IBA|GO:0097493;structural molecule activity conferring elasticity;IBA http://www.genecards.org/index.php?path=/Search/keyword/IGSF22 http://www.informatics.jax.org/searchtool/Search.do?query=IGSF22&submit=Quick%0D%14282ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=IGSF22 rs7125943 0.75619 0.7713 0.7413 0.15 2 13 exonic exonic exonic IGSF22 IGSF22 ENSG00000179057 nonsynonymous SNV nonsynonymous SNV unknown IGSF22:NM_173588:exon13:c.A1675G:p.M559V, IGSF22:uc009yht.2:exon13:c.A1675G:p.M559V, UNKNOWN Het;T>C 2365;126|108 Het;T>C 2296;94|103 Hom;T>C 5588;0|204 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 18737095 18737095 C T snp nonsynonymous SNV G1415A R472Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral IGSF22 ENSG00000179057 immunoglobulin superfamily member 22 chr11:18725852-18747777 GO:0006941;striated muscle contraction;IBA|GO:0007015;actin filament organization;IBA|GO:0045214;sarcomere organization;IBA|GO:0071688;striated muscle myosin thick filament assembly;IBA GO:0005859;muscle myosin complex;IBA|GO:0030018;Z disc;IBA|GO:0031430;M band;IBA GO:0008307;structural constituent of muscle;IBA|GO:0051015;actin filament binding;IBA|GO:0051371;muscle alpha-actinin binding;IBA|GO:0097493;structural molecule activity conferring elasticity;IBA http://www.genecards.org/index.php?path=/Search/keyword/IGSF22 http://www.informatics.jax.org/searchtool/Search.do?query=IGSF22&submit=Quick%0D%14282ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=IGSF22 rs4424652 0.749401 0.7576 0.7349 0.23 3 13 exonic exonic exonic IGSF22 IGSF22 ENSG00000179057 nonsynonymous SNV nonsynonymous SNV unknown IGSF22:NM_173588:exon11:c.G1415A:p.R472Q, IGSF22:uc009yht.2:exon11:c.G1415A:p.R472Q, UNKNOWN Het;C>T 2319;113|104 Het;C>T 1646;102|79 Hom;C>T 5306;0|198 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 18738281 18738281 C T snp nonsynonymous SNV G1240A V414I aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral IGSF22 ENSG00000179057 immunoglobulin superfamily member 22 chr11:18725852-18747777 GO:0006941;striated muscle contraction;IBA|GO:0007015;actin filament organization;IBA|GO:0045214;sarcomere organization;IBA|GO:0071688;striated muscle myosin thick filament assembly;IBA GO:0005859;muscle myosin complex;IBA|GO:0030018;Z disc;IBA|GO:0031430;M band;IBA GO:0008307;structural constituent of muscle;IBA|GO:0051015;actin filament binding;IBA|GO:0051371;muscle alpha-actinin binding;IBA|GO:0097493;structural molecule activity conferring elasticity;IBA http://www.genecards.org/index.php?path=/Search/keyword/IGSF22 http://www.informatics.jax.org/searchtool/Search.do?query=IGSF22&submit=Quick%0D%14282ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=IGSF22 rs10766494 0.749002 0.7605 0.7349 0.23 3 13 exonic exonic exonic IGSF22 IGSF22 ENSG00000179057 nonsynonymous SNV nonsynonymous SNV unknown IGSF22:NM_173588:exon10:c.G1240A:p.V414I, IGSF22:uc009yht.2:exon10:c.G1240A:p.V414I, UNKNOWN Het;C>T 459;30|21 Het;C>T 496;22|24 Hom;C>T 999;1|36 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 20805286 20805286 G A snp nonsynonymous SNV G329A R110Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral NELL1 Nell1 ENSG00000165973 neural EGFL like 1 chr11:20691117-21597227 This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Cholesterol; Exercise Test; Cholesterol, LDL; Calcium; longevity; Iron; Hemoglobins; Crohn Disease|Rectal Fistula; Platelet Count; Neuroblastoma; Type 2 Diabetes| edema | rosiglitazone; Albumins; Anticonvulsants; Amyotrophic Lateral Sclerosis|; Body Mass Index; Vitamin D; Lipoproteins, LDL; Forced Vital Capacity; Tobacco Use Disorder; Parkinson Disease; Crohn Disease; Asthma; Erythrocyte Count; Colitis, Ulcerative|Crohn Disease|; Leukocyte Count; Crohn's disease; Hypertrophy, Left Ventricular Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. GO:0007399;nervous system development;TAS|GO:0010468;regulation of gene expression;IDA|GO:0030154;cell differentiation;IEA|GO:0030501;positive regulation of bone mineralization;IDA|GO:0033689;negative regulation of osteoblast proliferation;IDA|GO:0045669;positive regulation of osteoblast differentiation;IDA|GO:1903363;negative regulation of cellular protein catabolic process;IDA GO:0005576;extracellular region;IEA|GO:0005634;nucleus;IEA|GO:0005635;nuclear envelope;IDA|GO:0005737;cytoplasm;IDA|GO:0048471;perinuclear region of cytoplasm;IDA GO:0005509;calcium ion binding;IEA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/NELL1 https://www.ncbi.nlm.nih.gov/omim/?term=602319 http://www.informatics.jax.org/searchtool/Search.do?query=NELL1&submit=Quick%0D%11669ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=NELL1 rs8176785 0.637181 0.6024 0.7362 0.38 5 13 exonic exonic exonic NELL1 NELL1 ENSG00000165973 nonsynonymous SNV nonsynonymous SNV unknown NELL1:NM_201551:exon3:c.G245A:p.R82Q,NELL1:NM_001288714:exon3:c.G245A:p.R82Q,NELL1:NM_001288713:exon4:c.G329A:p.R110Q,NELL1:NM_006157:exon3:c.G245A:p.R82Q, NELL1:uc009yid.3:exon4:c.G329A:p.R110Q,NELL1:uc001mqf.3:exon3:c.G245A:p.R82Q,NELL1:uc001mqe.3:exon3:c.G245A:p.R82Q,NELL1:uc010rdo.2:exon3:c.G245A:p.R82Q, UNKNOWN Het;G>A 1503;62|67 Het;G>A 1747;66|80 Hom;G>A 3168;2|116 11_21.322_43.322 Chr11:11392976-25199292 1.269 11 22647366 22647366 G A snp UTR5;UTR3 -10C>T FANCF Fancf ENSG00000183161 Fanconi anemia complementation group F chr11:22644079-22647387 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008] breast cancer ; epithelial ovarian cancer ; breast cancer; Adenocarcinoma|Pancreatic Neoplasms Fanconi Anemia Pathway GO:0001541;ovarian follicle development;IEA|GO:0006281;DNA repair;IEA|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007283;spermatogenesis;IEA|GO:0008150;biological_process;ND|GO:0016567;protein ubiquitination;IEA|GO:0036297;interstrand cross-link repair;TAS GO:0005634;nucleus;IEA|GO:0005654;nucleoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0003674;molecular_function;ND|GO:0005515;protein binding;IPI|GO:0061630;ubiquitin protein ligase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/FANCF https://hpo.jax.org/app/browse/search?q=FANCF&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=613897 http://www.informatics.jax.org/searchtool/Search.do?query=FANCF&submit=Quick%0D%14936ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCF rs3740615 0.113818 0.1466 0.1567 1 0 0 UTR5 UTR5 UTR5;UTR3 FANCF(NM_022725:c.-10C>T) FANCF(uc001mql.1:c.-10C>T) ENSG00000183161(ENST00000327470:c.-10C>T);ENSG00000229387(ENST00000428556:c.*247G>A) Na Na Na Na Na Na Het;G>A 1288;58|54 Het;G>A 1178;55|53 Hom;G>A 2863;0|102 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 66546100 66546100 A G snp nonsynonymous SNV T263C I88T aliphatic,hydrophobic,neutral polar,hydrophilic,neutral TMBIM4 Tmbim4 ENSG00000155957 transmembrane BAX inhibitor motif containing 4 chr12:66517709-66563852 GO:0006915;apoptotic process;IEA|GO:0043066;negative regulation of apoptotic process;IMP|GO:0050848;regulation of calcium-mediated signaling;IDA GO:0000139;Golgi membrane;IEA|GO:0005794;Golgi apparatus;IEA|GO:0005795;Golgi stack;IDA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/TMBIM4 https://www.uniprot.org/uniprot/Q9HC24 https://www.ncbi.nlm.nih.gov/omim/?term=616874 http://www.informatics.jax.org/searchtool/Search.do?query=TMBIM4&submit=Quick%0D%9918ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TMBIM4 rs8793 0.470447 0.3817 0.4472 0.08 1 13 exonic exonic exonic TMBIM4 TMBIM4 ENSG00000155957,ENSG00000228144 nonsynonymous SNV nonsynonymous SNV unknown TMBIM4:NM_001282606:exon4:c.T404C:p.I135T,TMBIM4:NM_001282609:exon3:c.T263C:p.I88T,TMBIM4:NM_001282610:exon3:c.T170C:p.I57T,TMBIM4:NM_016056:exon3:c.T263C:p.I88T, TMBIM4:uc001stc.3:exon3:c.T263C:p.I88T,TMBIM4:uc001std.3:exon3:c.T170C:p.I57T,TMBIM4:uc001stf.3:exon3:c.T263C:p.I88T,TMBIM4:uc009zqs.3:exon3:c.T263C:p.I88T,TMBIM4:uc009zqr.3:exon4:c.T404C:p.I135T, UNKNOWN Het;A>G 578;36|28 Het;A>G 932;19|42 Hom;A>G 2382;0|86 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 66725202 66725202 C T snp nonsynonymous SNV C2939T T980I polar,hydrophilic,neutral aliphatic,hydrophobic,neutral HELB Helb ENSG00000127311 DNA helicase B chr12:66696325-66737423 This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. GO:0006260;DNA replication;IMP|GO:0006261;DNA-dependent DNA replication;IEA|GO:0006269;DNA replication, synthesis of RNA primer;IDA|GO:0006281;DNA repair;IEA|GO:0006396;RNA processing;IBA|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0032508;DNA duplex unwinding;IEA|GO:1903775;regulation of DNA double-strand break processing;IMP|GO:2000042;negative regulation of double-strand break repair via homologous recombination;IMP GO:0005634;nucleus;IEA|GO:0005658;alpha DNA polymerase:primase complex;IDA|GO:0005662;DNA replication factor A complex;IDA|GO:0005694;chromosome;IEA|GO:0005737;cytoplasm;IEA|GO:0035861;site of double-strand break;IMP GO:0000166;nucleotide binding;IEA|GO:0004003;ATP-dependent DNA helicase activity;IEA|GO:0004004;ATP-dependent RNA helicase activity;IBA|GO:0004386;helicase activity;IEA|GO:0005524;ATP binding;IEA|GO:0016787;hydrolase activity;IEA|GO:0017116;single-stranded DNA-dependent ATP-dependent DNA helicase activity;IDA|GO:0043141;ATP-dependent 5'-3' DNA helicase activity;IDA http://www.genecards.org/index.php?path=/Search/keyword/HELB https://www.uniprot.org/uniprot/Q8NG08 https://www.ncbi.nlm.nih.gov/omim/?term=614539 http://www.informatics.jax.org/searchtool/Search.do?query=HELB&submit=Quick%0D%6017ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=HELB rs1168312 0.173722 0.1595 0.2101 0.23 3 13 exonic exonic exonic HELB HELB ENSG00000127311 nonsynonymous SNV nonsynonymous SNV unknown HELB:NM_033647:exon12:c.C2939T:p.T980I, HELB:uc001sti.3:exon12:c.C2939T:p.T980I, UNKNOWN Het;C>T 2122;132|97 Ref Hom;C>T 5667;2|214 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 71523134 71523134 A C snp nonsynonymous SNV T637G S213A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral TSPAN8 Tspan8 ENSG00000127324 tetraspanin 8 chr12:71518865-71835678 The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008] Type 2 diabetes|reduced prostate cancer risk; schizophrenia | bipolar disorder; type 2 diabetes; obesity; Diabetes mellitus|HIV Infections|[X]Human immunodeficiency virus disease; Posttransplantation diabetes mellitus (PTDM); Cardiovascular Diseases; Macular Degeneration; diabetes, type 2; Diabetes Mellitus, Type 2|; latent autoimmune diabetes; Diabetes Mellitus, Type 2; Creutzfeldt-Jakob Syndrome; Tobacco Use Disorder; Arthritis, Rheumatoid|Crohn Disease|Crohn's disease|Diabetes mellitus|Disease|Rheumatoid Arthritis; Type 2 diabetes GO:0007166;cell surface receptor signaling pathway;IBA|GO:0007283;spermatogenesis;IEA|GO:0010468;regulation of gene expression;IEA|GO:0030195;negative regulation of blood coagulation;IEA GO:0005887;integral component of plasma membrane;IBA|GO:0009986;cell surface;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005178;integrin binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/TSPAN8 https://www.uniprot.org/uniprot/P19075 https://www.ncbi.nlm.nih.gov/omim/?term=600769 http://www.informatics.jax.org/searchtool/Search.do?query=TSPAN8&submit=Quick%0D%6020ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TSPAN8 rs1051334 0.250799 0.3355 0.3449 0.23 3 13 exonic exonic exonic TSPAN8 TSPAN8 ENSG00000127324 nonsynonymous SNV nonsynonymous SNV unknown TSPAN8:NM_004616:exon8:c.T637G:p.S213A, TSPAN8:uc009zrt.1:exon7:c.T637G:p.S213A,TSPAN8:uc001swk.1:exon11:c.T637G:p.S213A,TSPAN8:uc001swj.1:exon8:c.T637G:p.S213A, UNKNOWN Het;A>C 400;32|24 Ref Hom;A>C 1880;0|71 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 71533534 71533534 C G snp nonsynonymous SNV G218C G73A aliphatic,neutral aliphatic,hydrophobic,neutral TSPAN8 Tspan8 ENSG00000127324 tetraspanin 8 chr12:71518865-71835678 The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008] Type 2 diabetes|reduced prostate cancer risk; schizophrenia | bipolar disorder; type 2 diabetes; obesity; Diabetes mellitus|HIV Infections|[X]Human immunodeficiency virus disease; Posttransplantation diabetes mellitus (PTDM); Cardiovascular Diseases; Macular Degeneration; diabetes, type 2; Diabetes Mellitus, Type 2|; latent autoimmune diabetes; Diabetes Mellitus, Type 2; Creutzfeldt-Jakob Syndrome; Tobacco Use Disorder; Arthritis, Rheumatoid|Crohn Disease|Crohn's disease|Diabetes mellitus|Disease|Rheumatoid Arthritis; Type 2 diabetes GO:0007166;cell surface receptor signaling pathway;IBA|GO:0007283;spermatogenesis;IEA|GO:0010468;regulation of gene expression;IEA|GO:0030195;negative regulation of blood coagulation;IEA GO:0005887;integral component of plasma membrane;IBA|GO:0009986;cell surface;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005178;integrin binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/TSPAN8 https://www.uniprot.org/uniprot/P19075 https://www.ncbi.nlm.nih.gov/omim/?term=600769 http://www.informatics.jax.org/searchtool/Search.do?query=TSPAN8&submit=Quick%0D%6020ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TSPAN8 rs3763978 0.227037 0.3082 0.3332 0.85 11 13 exonic exonic exonic TSPAN8 TSPAN8 ENSG00000127324 nonsynonymous SNV nonsynonymous SNV unknown TSPAN8:NM_004616:exon4:c.G218C:p.G73A, TSPAN8:uc009zrt.1:exon3:c.G218C:p.G73A,TSPAN8:uc001swk.1:exon7:c.G218C:p.G73A,TSPAN8:uc001swj.1:exon4:c.G218C:p.G73A, UNKNOWN Het;C>G 1127;99|52 Ref Hom;C>G 3385;2|123 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 72057375 72057375 T C snp nonsynonymous SNV A16G T6A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral ZFC3H1 Zfc3h1 ENSG00000133858 zinc finger C3H1-type containing chr12:72003252-72061505 Coronary Artery Disease; Lipoproteins GO:0006396;RNA processing;IEA GO:0005615;extracellular space;IDA GO:0003723;RNA binding;IDA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZFC3H1 https://www.uniprot.org/uniprot/O60293 http://www.informatics.jax.org/searchtool/Search.do?query=ZFC3H1&submit=Quick%0D%6878ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZFC3H1 rs368259965 0.00159744 8e-05 0.0009 0.00 0 13 exonic exonic exonic ZFC3H1 ZFC3H1 ENSG00000133858 nonsynonymous SNV nonsynonymous SNV unknown ZFC3H1:NM_144982:exon1:c.A16G:p.T6A, ZFC3H1:uc001swp.3:exon1:c.A16G:p.T6A,ZFC3H1:uc001swo.2:exon1:c.A16G:p.T6A,ZFC3H1:uc010sts.2:exon1:c.A16G:p.T6A, UNKNOWN Het;T>C 1161;52|50 Ref Hom;T>C 2379;0|87 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 75900382 75900382 C T snp nonsynonymous SNV G401A R134Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral KRR1 Krr1 ENSG00000111615 KRR1, small subunit processome component homolog chr12:75890684-75905416 monocyte chemoattractant protein 1 (66-77); Type 2 Diabetes| edema | rosiglitazone Major pathway of rRNA processing in the nucleolus and cytosol GO:0000462;maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA);IBA|GO:0006364;rRNA processing;TAS|GO:0042254;ribosome biogenesis;IEA GO:0005634;nucleus;IDA|GO:0005654;nucleoplasm;TAS|GO:0005730;nucleolus;IDA|GO:0005737;cytoplasm;IEA|GO:0016020;membrane;IDA|GO:0030529;intracellular ribonucleoprotein complex;IEA|GO:0032040;small-subunit processome;IBA|GO:0045171;intercellular bridge;IDA GO:0003676;nucleic acid binding;IEA|GO:0003723;RNA binding;IDA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/KRR1 https://www.uniprot.org/uniprot/Q13601 https://www.ncbi.nlm.nih.gov/omim/?term=612817 http://www.informatics.jax.org/searchtool/Search.do?query=KRR1&submit=Quick%0D%4093ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KRR1 rs11540407 0.232029 0.2327 0.2540 0.77 10 13 exonic exonic exonic KRR1 KRR1 ENSG00000111615 nonsynonymous SNV nonsynonymous SNV unknown KRR1:NM_007043:exon4:c.G401A:p.R134Q, KRR1:uc009zsc.3:exon4:c.G401A:p.R134Q,KRR1:uc010stx.2:exon4:c.G401A:p.R134Q,KRR1:uc001sxt.3:exon4:c.G401A:p.R134Q, UNKNOWN Het;C>T 204;13|11 Ref Hom;C>T 640;0|23 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 80752660 80752660 A G snp nonsynonymous SNV A6220G I2074V aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral OTOGL Otogl ENSG00000165899 otogelin like chr12:80603233-80772870 The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012] Moderate Sensorineural Hearing Loss GO:0007605;sensory perception of sound;IEA|GO:0046373;L-arabinose metabolic process;IEA GO:0005576;extracellular region;IEA GO:0046556;alpha-L-arabinofuranosidase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/OTOGL https://hpo.jax.org/app/browse/search?q=OTOGL&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=614925 http://www.informatics.jax.org/searchtool/Search.do?query=OTOGL&submit=Quick%0D%11650ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OTOGL rs2034528 0.964457 0.9358 0.9400 0.15 2 13 exonic exonic exonic OTOGL OTOGL ENSG00000165899 nonsynonymous SNV nonsynonymous SNV unknown OTOGL:NM_173591:exon51:c.A6220G:p.I2074V, OTOGL:uc001szd.3:exon51:c.A6220G:p.I2074V,OTOGL:uc021rba.1:exon5:c.A277G:p.I93V, UNKNOWN Het;A>G 249;11|11 Het;A>G 462;15|17 Hom;A>G 678;0|23 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 80904143 80904143 T C snp nonsynonymous SNV T2083C S695P polar,hydrophilic,neutral hydrophobic,neutral PTPRQ Ptprq ENSG00000139304 protein tyrosine phosphatase, receptor type Q chr12:80799774-81072802 This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014] Erythrocyte Indices; Electrocardiography; Uric Acid; Bipolar Disorder; Tobacco Use Disorder; Exercise Test Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. GO:0002244;hematopoietic progenitor cell differentiation;IEA|GO:0006470;protein dephosphorylation;IEA|GO:0007155;cell adhesion;IEA|GO:0016311;dephosphorylation;IEA|GO:0030154;cell differentiation;IEA|GO:0035335;peptidyl-tyrosine dephosphorylation;IEA|GO:0042472;inner ear morphogenesis;IEA|GO:0046856;phosphatidylinositol dephosphorylation;IEA|GO:0050767;regulation of neurogenesis;IEA|GO:0050885;neuromuscular process controlling balance;IEA|GO:0050910;detection of mechanical stimulus involved in sensory perception of sound;IEA|GO:0060116;vestibular receptor cell morphogenesis;IEA GO:0005578;proteinaceous extracellular matrix;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0032421;stereocilium bundle;IEA GO:0004721;phosphoprotein phosphatase activity;IEA|GO:0004725;protein tyrosine phosphatase activity;IEA|GO:0016787;hydrolase activity;IEA|GO:0016791;phosphatase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PTPRQ https://www.uniprot.org/uniprot/Q9UMZ3 https://hpo.jax.org/app/browse/search?q=PTPRQ&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=603317 http://www.informatics.jax.org/searchtool/Search.do?query=PTPRQ&submit=Quick%0D%7868ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PTPRQ rs143156047 0.00119808 0.0024 0.0022 0.75 6 8 exonic exonic exonic PTPRQ PTPRQ ENSG00000139304 nonsynonymous SNV nonsynonymous SNV unknown PTPRQ:NM_001145026:exon14:c.T2083C:p.S695P, PTPRQ:uc001sze.2:exon14:c.T2083C:p.S695P, UNKNOWN Het;T>C 1719;91|80 Ref Hom;T>C 7432;0|285 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 88440676 88440676 G C snp nonsynonymous SNV G712C V238L aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral C12orf29 4930430F08Rik ENSG00000133641 chromosome 12 open reading frame 29 chr12:88427623-88443937 GO:0002244;hematopoietic progenitor cell differentiation;IEA http://www.genecards.org/index.php?path=/Search/keyword/C12orf29 https://www.uniprot.org/uniprot/Q8N999 http://www.informatics.jax.org/searchtool/Search.do?query=C12orf29&submit=Quick%0D%6854ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=C12orf29 rs9262 0.510583 0.4692 0.5827 0.08 1 13 exonic exonic exonic C12orf29 C12orf29 ENSG00000133641 nonsynonymous SNV nonsynonymous SNV unknown C12orf29:NM_001009894:exon6:c.G712C:p.V238L, C12orf29:uc001tao.3:exon6:c.G712C:p.V238L, UNKNOWN Het;G>C 1429;75|65 Ref Hom;G>C 8260;0|299 12_78.016_106.016 Chr12:64973018-92996828 1.299 12 89745477 89745477 C A snp nonsynonymous SNV G340T V114L aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral DUSP6 Dusp6 ENSG00000139318 dual specificity phosphatase 6 chr12:89741009-89747048 The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014] Atrial Fibrillation; affective disorder; Type 2 Diabetes| edema | rosiglitazone; Chronic renal failure|Kidney Failure, Chronic; Bipolar Disorder; longevity Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. Negative regulation of MAPK pathway GO:0000165;MAPK cascade;TAS|GO:0000187;activation of MAPK activity;TAS|GO:0000188;inactivation of MAPK activity;IDA|GO:0001933;negative regulation of protein phosphorylation;IEA|GO:0006470;protein dephosphorylation;IEA|GO:0009953;dorsal/ventral pattern formation;IBA|GO:0010033;response to organic substance;IEA|GO:0010942;positive regulation of cell death;IEA|GO:0014070;response to organic cyclic compound;IEA|GO:0016311;dephosphorylation;IEA|GO:0030154;cell differentiation;IEA|GO:0035335;peptidyl-tyrosine dephosphorylation;IDA|GO:0040036;regulation of fibroblast growth factor receptor signaling pathway;IBA|GO:0042493;response to drug;IEA|GO:0042663;regulation of endodermal cell fate specification;IBA|GO:0043065;positive regulation of apoptotic process;IDA|GO:0051409;response to nitrosative stress;IEP|GO:0060420;regulation of heart growth;IBA|GO:0070373;negative regulation of ERK1 and ERK2 cascade;IMP|GO:0070848;response to growth factor;IEA GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;IDA|GO:0005829;cytosol;TAS GO:0004721;phosphoprotein phosphatase activity;IEA|GO:0004725;protein tyrosine phosphatase activity;TAS|GO:0008138;protein tyrosine/serine/threonine phosphatase activity;TAS|GO:0016787;hydrolase activity;IEA|GO:0016791;phosphatase activity;IEA|GO:0017017;MAP kinase tyrosine/serine/threonine phosphatase activity;IDA http://www.genecards.org/index.php?path=/Search/keyword/DUSP6 https://www.uniprot.org/uniprot/Q16828 https://hpo.jax.org/app/browse/search?q=DUSP6&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=602748 http://www.informatics.jax.org/searchtool/Search.do?query=DUSP6&submit=Quick%0D%7869ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=DUSP6 rs2279574 0.466254 0.4316 0.5378 0.46 6 13 exonic exonic exonic DUSP6 DUSP6 ENSG00000139318 nonsynonymous SNV nonsynonymous SNV unknown DUSP6:NM_022652:exon1:c.G340T:p.V114L,DUSP6:NM_001946:exon1:c.G340T:p.V114L, DUSP6:uc001taz.3:exon1:c.G340T:p.V114L,DUSP6:uc001tay.3:exon1:c.G340T:p.V114L, UNKNOWN Het;C>A 632;30|29 Het;C>A 390;24|20 Hom;C>A 1428;0|51 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 81056441 81056441 T G snp stoploss T613G X205E polar,hydrophilic,charged(-) CENPN Cenpn ENSG00000166451 centromere protein N chr16:81040103-81066719 The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] smoking cessation Mitotic Prometaphase GO:0007059;chromosome segregation;IEA|GO:0007062;sister chromatid cohesion;TAS|GO:0034080;CENP-A containing nucleosome assembly;TAS|GO:0034508;centromere complex assembly;IEA GO:0000775;chromosome, centromeric region;IEA|GO:0000776;kinetochore;IEA|GO:0000777;condensed chromosome kinetochore;IEA|GO:0005634;nucleus;IDA|GO:0005654;nucleoplasm;TAS|GO:0005694;chromosome;IEA|GO:0005829;cytosol;TAS http://www.genecards.org/index.php?path=/Search/keyword/CENPN https://www.ncbi.nlm.nih.gov/omim/?term=611509 http://www.informatics.jax.org/searchtool/Search.do?query=CENPN&submit=Quick%0D%11797ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CENPN rs3743503 0.132588 0.0998 0.1412 0.25 1 4 exonic exonic exonic CENPN CENPN ENSG00000166451 stoploss stoploss unknown CENPN:NM_018455:exon7:c.T613G:p.X205E, CENPN:uc002ffw.4:exon7:c.T613G:p.X205E, UNKNOWN Het;T>G 1755;64|73 Het;T>G 1219;52|54 Hom;T>G 3716;0|138 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 81094951 81094951 A G snp nonsynonymous SNV T1003C Y335H aromatic,polar,hydrophobic aromatic,polar,hydrophilic,charged(+) C16orf46 1700030J22Rik ENSG00000166455 chromosome 16 open reading frame 46 chr16:81087102-81110872 Attention deficit hyperactivity disorder and conduct disorder; smoking cessation; Tobacco Use Disorder; Body Weights and Measures GO:0005634;nucleus;IDA|GO:0005654;nucleoplasm;IDA|GO:0005829;cytosol;IDA http://www.genecards.org/index.php?path=/Search/keyword/C16orf46 http://www.informatics.jax.org/searchtool/Search.do?query=C16orf46&submit=Quick%0D%11800ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=C16orf46 rs10459872 0.104633 0.0654 0.1022 0.08 1 13 exonic exonic exonic C16orf46 C16orf46 ENSG00000166455 nonsynonymous SNV nonsynonymous SNV unknown C16orf46:NM_152337:exon4:c.T1003C:p.Y335H,C16orf46:NM_001100873:exon3:c.T1003C:p.Y335H, C16orf46:uc010chf.3:exon3:c.T1003C:p.Y335H,C16orf46:uc002fgc.4:exon4:c.T1003C:p.Y335H, UNKNOWN Het;A>G 1256;64|52 Het;A>G 2131;66|90 Hom;A>G 3965;0|130 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 81208512 81208512 A C snp nonsynonymous SNV T2591G L864R aliphatic,hydrophobic,neutral polar,hydrophilic,charged(+) PKD1L2 Pkd1l2 ENSG00000166473 polycystin 1 like 2 (gene/pseudogene) chr16:81134480-81253975 This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Attention deficit hyperactivity disorder and conduct disorder; HIV Infections|[X]Human immunodeficiency virus disease; beta Carotene; Diabetic Nephropathies; high-density lipoprotein cholesterol ; smoking cessation; E-Selectin; Attention Deficit and Disruptive Behavior Disorders GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0050982;detection of mechanical stimulus;IBA|GO:0070588;calcium ion transmembrane transport;IEA GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005262;calcium channel activity;IBA|GO:0005509;calcium ion binding;IEA|GO:0030246;carbohydrate binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/PKD1L2 https://www.ncbi.nlm.nih.gov/omim/?term=607894 http://www.informatics.jax.org/searchtool/Search.do?query=PKD1L2&submit=Quick%0D%11802ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PKD1L2 rs199798228 0.00219649 0.0004 0.0027 0.09 1 11 exonic exonic exonic PKD1L2 PKD1L2 ENSG00000166473 nonsynonymous SNV nonsynonymous SNV unknown PKD1L2:NM_001278423:exon5:c.T536G:p.L179R,PKD1L2:NM_001076780:exon16:c.T2591G:p.L864R, PKD1L2:uc002fgj.3:exon16:c.T2591G:p.L864R,PKD1L2:uc002fgl.1:exon4:c.T359G:p.L120R,PKD1L2:uc002fgi.3:exon5:c.T536G:p.L179R,PKD1L2:uc002fgk.1:exon3:c.T17G:p.L6R, UNKNOWN Het;A>C 777;21|32 Het;A>C 436;24|22 Hom;A>C 1324;4|53 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 81213378 81213378 A G snp nonsynonymous SNV T2132C L711P aliphatic,hydrophobic,neutral hydrophobic,neutral PKD1L2 Pkd1l2 ENSG00000166473 polycystin 1 like 2 (gene/pseudogene) chr16:81134480-81253975 This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Attention deficit hyperactivity disorder and conduct disorder; HIV Infections|[X]Human immunodeficiency virus disease; beta Carotene; Diabetic Nephropathies; high-density lipoprotein cholesterol ; smoking cessation; E-Selectin; Attention Deficit and Disruptive Behavior Disorders GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0050982;detection of mechanical stimulus;IBA|GO:0070588;calcium ion transmembrane transport;IEA GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005262;calcium channel activity;IBA|GO:0005509;calcium ion binding;IEA|GO:0030246;carbohydrate binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/PKD1L2 https://www.ncbi.nlm.nih.gov/omim/?term=607894 http://www.informatics.jax.org/searchtool/Search.do?query=PKD1L2&submit=Quick%0D%11802ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PKD1L2 rs4889261 0.80012 0.8006 0.8196 0.27 3 11 exonic exonic exonic PKD1L2 PKD1L2 ENSG00000166473 nonsynonymous SNV nonsynonymous SNV unknown PKD1L2:NM_001278423:exon2:c.T77C:p.L26P,PKD1L2:NM_001076780:exon13:c.T2132C:p.L711P, PKD1L2:uc002fgj.3:exon13:c.T2132C:p.L711P,PKD1L2:uc002fgl.1:exon2:c.T77C:p.L26P,PKD1L2:uc002fgi.3:exon2:c.T77C:p.L26P, UNKNOWN Het;A>G 687;48|34 Het;A>G 441;49|27 Hom;A>G 2401;0|88 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 81314496 81314496 C T snp nonsynonymous SNV C929T A310V aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral BCMO1 rs7501331 0.152157 0.1716 0.2125 0.38 5 13 exonic exonic exonic BCO1 BCMO1 ENSG00000135697 nonsynonymous SNV nonsynonymous SNV unknown BCO1:NM_017429:exon8:c.C1136T:p.A379V, BCMO1:uc010vnp.1:exon7:c.C929T:p.A310V,BCMO1:uc002fgn.1:exon8:c.C1136T:p.A379V, UNKNOWN Het;C>T 710;89|38 Het;C>T 745;78|42 Hom;C>T 3062;0|116 16_101.974_110.974 Chr16:79461830-82833302 0.225 16 82033810 82033810 G A snp stopgain C88T Q30X polar,hydrophilic,neutral SDR42E1 Sdr42e1 ENSG00000184860 short chain dehydrogenase/reductase family 42E, member 1 chr16:82031221-82045093 GO:0006694;steroid biosynthetic process;IEA|GO:0055114;oxidation-reduction process;IEA GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0003854;3-beta-hydroxy-delta5-steroid dehydrogenase activity;IEA|GO:0016491;oxidoreductase activity;IEA|GO:0016616;oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor;IEA http://www.genecards.org/index.php?path=/Search/keyword/SDR42E1 https://www.ncbi.nlm.nih.gov/omim/?term=616164 http://www.informatics.jax.org/searchtool/Search.do?query=SDR42E1&submit=Quick%0D%15284ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=SDR42E1 rs11542462 0.0728834 0.0920 0.1059 0.80 4 5 exonic exonic exonic SDR42E1 SDR42E1 ENSG00000184860 stopgain stopgain unknown SDR42E1:NM_145168:exon3:c.C88T:p.Q30X, SDR42E1:uc002fgu.3:exon3:c.C88T:p.Q30X, UNKNOWN Het;G>A 917;55|37 Het;G>A 981;41|47 Hom;G>A 2360;0|79 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88066717 88066717 C T snp nonsynonymous SNV C1042T P348S hydrophobic,neutral polar,hydrophilic,neutral BANP Banp ENSG00000172530 BTG3 associated nuclear protein chr16:87982850-88110924 This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] Fibrinogen; Menopause; Stroke; Cornea; Tobacco Use Disorder Regulation of TP53 Activity through Association with Co-factors GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0007049;cell cycle;IEA|GO:0007275;multicellular organism development;IEA|GO:0016569;covalent chromatin modification;IEA|GO:0034504;protein localization to nucleus;IEA|GO:0042177;negative regulation of protein catabolic process;IEA|GO:0045893;positive regulation of transcription, DNA-templated;IEA|GO:1901796;regulation of signal transduction by p53 class mediator;TAS GO:0005634;nucleus;IEA|GO:0005654;nucleoplasm;TAS|GO:0016604;nuclear body;IDA GO:0002039;p53 binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/BANP https://www.ncbi.nlm.nih.gov/omim/?term=611564 http://www.informatics.jax.org/searchtool/Search.do?query=BANP&submit=Quick%0D%13183ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=BANP rs74992447 0.184305 0.1221 0.1487 0.17 2 12 exonic exonic exonic BANP BANP ENSG00000172530 nonsynonymous SNV nonsynonymous SNV unknown BANP:NM_017869:exon8:c.C949T:p.P317S,BANP:NM_001173539:exon9:c.C1066T:p.P356S,BANP:NM_001173541:exon8:c.C949T:p.P317S,BANP:NM_001173540:exon8:c.C967T:p.P323S,BANP:NM_001173542:exon9:c.C1066T:p.P356S,BANP:NM_001173543:exon9:c.C1042T:p.P348S,BANP:NM_079837:exon8:c.C949T:p.P317S, BANP:uc002fkr.3:exon9:c.C1042T:p.P348S,BANP:uc002fkq.3:exon8:c.C949T:p.P317S,BANP:uc021tml.1:exon9:c.C1066T:p.P356S,BANP:uc002fko.1:exon8:c.C757T:p.P253S,BANP:uc010vow.2:exon9:c.C1066T:p.P356S,BANP:uc002fkp.3:exon8:c.C949T:p.P317S,BANP:uc002fks.4:exon8:c.C949T:p.P317S,BANP:uc010vov.2:exon8:c.C967T:p.P323S, UNKNOWN Het;C>T 2259;121|103 Ref Hom;C>T 4616;0|169 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88778615 88778615 G A snp nonsynonymous SNV G490A V164M aliphatic,hydrophobic,neutral hydrophobic,neutral CTU2 Ctu2 ENSG00000174177 cytosolic thiouridylase subunit 2 chr16:88772871-88781794 This gene encodes a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs). The encoded protein plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016] tRNA modification in the nucleus and cytosol GO:0002098;tRNA wobble uridine modification;IEA|GO:0002143;tRNA wobble position uridine thiolation;IBA|GO:0006400;tRNA modification;TAS|GO:0008033;tRNA processing;IEA|GO:0032447;protein urmylation;IEA|GO:0034227;tRNA thio-modification;IEA GO:0005737;cytoplasm;IEA|GO:0005829;cytosol;TAS|GO:0043234;protein complex;IDA GO:0000049;tRNA binding;IEA|GO:0005515;protein binding;IPI|GO:0016779;nucleotidyltransferase activity;IEA|GO:0016783;sulfurtransferase activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/CTU2 https://hpo.jax.org/app/browse/search?q=CTU2&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=617057 http://www.informatics.jax.org/searchtool/Search.do?query=CTU2&submit=Quick%0D%13486ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CTU2 rs7205989 0.576278 0 0.6018 0.14 1 7 intronic exonic exonic CTU2 CTU2 ENSG00000174177 Na nonsynonymous SNV unknown Na CTU2:uc010chz.3:exon6:c.G490A:p.V164M, UNKNOWN Het;G>A 1801;80|79 Ref Hom;G>A 3554;1|129 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88800060 88800060 C T snp nonsynonymous SNV G2423A R808Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral PIEZO1 Piezo1 ENSG00000103335 piezo type mechanosensitive ion channel component 1 chr16:88781751-88851619 The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015] Arteries Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006812;cation transport;ISS|GO:0033625;positive regulation of integrin activation;IMP|GO:0033634;positive regulation of cell-cell adhesion mediated by integrin;IMP|GO:0034220;ion transmembrane transport;IEA|GO:0042391;regulation of membrane potential;IBA|GO:0050982;detection of mechanical stimulus;IBA|GO:0071260;cellular response to mechanical stimulus;IBA|GO:0098655;cation transmembrane transport;IEA GO:0005783;endoplasmic reticulum;IDA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0005886;plasma membrane;IBA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0031258;lamellipodium membrane;IEA|GO:0033116;endoplasmic reticulum-Golgi intermediate compartment membrane;IEA|GO:0042995;cell projection;IEA GO:0005261;cation channel activity;IBA|GO:0008381;mechanically-gated ion channel activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PIEZO1 https://www.uniprot.org/uniprot/Q92508 https://hpo.jax.org/app/browse/search?q=PIEZO1&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=611184 http://www.informatics.jax.org/searchtool/Search.do?query=PIEZO1&submit=Quick%0D%3008ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PIEZO1 rs202103485 0.000798722 0 0.0026 0.62 8 13 exonic exonic exonic PIEZO1 PIEZO1 ENSG00000103335 nonsynonymous SNV nonsynonymous SNV unknown PIEZO1:NM_001142864:exon18:c.G2423A:p.R808Q, PIEZO1:uc010vpb.2:exon18:c.G2423A:p.R808Q,PIEZO1:uc010cib.3:exon7:c.G1034A:p.R345Q, UNKNOWN Het;C>T 2249;90|100 Ref Hom;C>T 4310;1|157 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88800139 88800139 C T snp nonsynonymous SNV G2344A G782S aliphatic,neutral polar,hydrophilic,neutral PIEZO1 Piezo1 ENSG00000103335 piezo type mechanosensitive ion channel component 1 chr16:88781751-88851619 The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015] Arteries Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006812;cation transport;ISS|GO:0033625;positive regulation of integrin activation;IMP|GO:0033634;positive regulation of cell-cell adhesion mediated by integrin;IMP|GO:0034220;ion transmembrane transport;IEA|GO:0042391;regulation of membrane potential;IBA|GO:0050982;detection of mechanical stimulus;IBA|GO:0071260;cellular response to mechanical stimulus;IBA|GO:0098655;cation transmembrane transport;IEA GO:0005783;endoplasmic reticulum;IDA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0005886;plasma membrane;IBA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0031258;lamellipodium membrane;IEA|GO:0033116;endoplasmic reticulum-Golgi intermediate compartment membrane;IEA|GO:0042995;cell projection;IEA GO:0005261;cation channel activity;IBA|GO:0008381;mechanically-gated ion channel activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PIEZO1 https://www.uniprot.org/uniprot/Q92508 https://hpo.jax.org/app/browse/search?q=PIEZO1&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=611184 http://www.informatics.jax.org/searchtool/Search.do?query=PIEZO1&submit=Quick%0D%3008ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PIEZO1 rs200970763 0.000798722 0 0.0033 0.62 8 13 exonic exonic exonic PIEZO1 PIEZO1 ENSG00000103335 nonsynonymous SNV nonsynonymous SNV unknown PIEZO1:NM_001142864:exon18:c.G2344A:p.G782S, PIEZO1:uc010vpb.2:exon18:c.G2344A:p.G782S,PIEZO1:uc010cib.3:exon7:c.G955A:p.G319S, UNKNOWN Het;C>T 1388;56|61 Ref Hom;C>T 2974;0|107 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88803124 88803124 T C snp nonsynonymous SNV A1219G R407G polar,hydrophilic,charged(+) aliphatic,neutral PIEZO1 Piezo1 ENSG00000103335 piezo type mechanosensitive ion channel component 1 chr16:88781751-88851619 The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015] Arteries Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006812;cation transport;ISS|GO:0033625;positive regulation of integrin activation;IMP|GO:0033634;positive regulation of cell-cell adhesion mediated by integrin;IMP|GO:0034220;ion transmembrane transport;IEA|GO:0042391;regulation of membrane potential;IBA|GO:0050982;detection of mechanical stimulus;IBA|GO:0071260;cellular response to mechanical stimulus;IBA|GO:0098655;cation transmembrane transport;IEA GO:0005783;endoplasmic reticulum;IDA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0005886;plasma membrane;IBA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0031258;lamellipodium membrane;IEA|GO:0033116;endoplasmic reticulum-Golgi intermediate compartment membrane;IEA|GO:0042995;cell projection;IEA GO:0005261;cation channel activity;IBA|GO:0008381;mechanically-gated ion channel activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PIEZO1 https://www.uniprot.org/uniprot/Q92508 https://hpo.jax.org/app/browse/search?q=PIEZO1&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=611184 http://www.informatics.jax.org/searchtool/Search.do?query=PIEZO1&submit=Quick%0D%3008ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PIEZO1 rs13333358 0.430312 0.3507 0.3243 0.17 2 12 exonic exonic exonic PIEZO1 PIEZO1 ENSG00000103335 nonsynonymous SNV nonsynonymous SNV unknown PIEZO1:NM_001142864:exon11:c.A1219G:p.R407G, PIEZO1:uc010vpb.2:exon11:c.A1219G:p.R407G, UNKNOWN Het;T>C 509;17|26 Het;T>C 354;14|17 Hom;T>C 826;0|30 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88872229 88872229 A G snp nonsynonymous SNV A784G T262A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral CDT1 Cdt1 ENSG00000167513 chromatin licensing and DNA replication factor 1 chr16:88869621-88875666 The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011] breast cancer Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. Removal of licensing factors from origins GO:0000076;DNA replication checkpoint;IDA|GO:0000082;G1/S transition of mitotic cell cycle;TAS|GO:0000083;regulation of transcription involved in G1/S transition of mitotic cell cycle;TAS|GO:0000278;mitotic cell cycle;IMP|GO:0006260;DNA replication;IEA|GO:0007049;cell cycle;IEA|GO:0007059;chromosome segregation;IMP|GO:0030174;regulation of DNA-dependent DNA replication initiation;IDA|GO:0031334;positive regulation of protein complex assembly;IMP|GO:0033044;regulation of chromosome organization;IMP|GO:0033262;regulation of nuclear cell cycle DNA replication;IEA|GO:0035563;positive regulation of chromatin binding;IDA|GO:0051301;cell division;IMP|GO:0051315;attachment of mitotic spindle microtubules to kinetochore;IMP|GO:0051383;kinetochore organization;IMP|GO:0071163;DNA replication preinitiation complex assembly;IDA|GO:0072708;response to sorbitol;IDA|GO:1902426;deactivation of mitotic spindle assembly checkpoint;IMP|GO:1902595;regulation of DNA replication origin binding;IDA|GO:1905341;negative regulation of protein localization to kinetochore;IMP|GO:1905342;positive regulation of protein localization to kinetochore;IMP|GO:2000105;positive regulation of DNA-dependent DNA replication;IDA|GO:2001178;positive regulation of mediator complex assembly;IDA GO:0000775;chromosome, centromeric region;IEA|GO:0000776;kinetochore;IEA|GO:0000777;condensed chromosome kinetochore;IEA|GO:0005634;nucleus;IDA|GO:0005654;nucleoplasm;TAS|GO:0005694;chromosome;IEA|GO:0005829;cytosol;TAS|GO:0016604;nuclear body;IDA GO:0003677;DNA binding;IEA|GO:0003682;chromatin binding;IDA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/CDT1 https://hpo.jax.org/app/browse/search?q=CDT1&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=605525 http://www.informatics.jax.org/searchtool/Search.do?query=CDT1&submit=Quick%0D%12024ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CDT1 rs480727 0.571286 0.4955 0.4442 0.08 1 13 exonic exonic exonic CDT1 CDT1 ENSG00000167513 nonsynonymous SNV nonsynonymous SNV unknown CDT1:NM_030928:exon5:c.A784G:p.T262A, CDT1:uc002flu.3:exon5:c.A784G:p.T262A, UNKNOWN Het;A>G 1790;98|77 Het;A>G 1740;65|80 Hom;A>G 4344;0|146 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 88874555 88874555 G C snp nonsynonymous SNV G1510C E504Q polar,hydrophilic,charged(-) polar,hydrophilic,neutral CDT1 Cdt1 ENSG00000167513 chromatin licensing and DNA replication factor 1 chr16:88869621-88875666 The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011] breast cancer Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. Removal of licensing factors from origins GO:0000076;DNA replication checkpoint;IDA|GO:0000082;G1/S transition of mitotic cell cycle;TAS|GO:0000083;regulation of transcription involved in G1/S transition of mitotic cell cycle;TAS|GO:0000278;mitotic cell cycle;IMP|GO:0006260;DNA replication;IEA|GO:0007049;cell cycle;IEA|GO:0007059;chromosome segregation;IMP|GO:0030174;regulation of DNA-dependent DNA replication initiation;IDA|GO:0031334;positive regulation of protein complex assembly;IMP|GO:0033044;regulation of chromosome organization;IMP|GO:0033262;regulation of nuclear cell cycle DNA replication;IEA|GO:0035563;positive regulation of chromatin binding;IDA|GO:0051301;cell division;IMP|GO:0051315;attachment of mitotic spindle microtubules to kinetochore;IMP|GO:0051383;kinetochore organization;IMP|GO:0071163;DNA replication preinitiation complex assembly;IDA|GO:0072708;response to sorbitol;IDA|GO:1902426;deactivation of mitotic spindle assembly checkpoint;IMP|GO:1902595;regulation of DNA replication origin binding;IDA|GO:1905341;negative regulation of protein localization to kinetochore;IMP|GO:1905342;positive regulation of protein localization to kinetochore;IMP|GO:2000105;positive regulation of DNA-dependent DNA replication;IDA|GO:2001178;positive regulation of mediator complex assembly;IDA GO:0000775;chromosome, centromeric region;IEA|GO:0000776;kinetochore;IEA|GO:0000777;condensed chromosome kinetochore;IEA|GO:0005634;nucleus;IDA|GO:0005654;nucleoplasm;TAS|GO:0005694;chromosome;IEA|GO:0005829;cytosol;TAS|GO:0016604;nuclear body;IDA GO:0003677;DNA binding;IEA|GO:0003682;chromatin binding;IDA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/CDT1 https://hpo.jax.org/app/browse/search?q=CDT1&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=605525 http://www.informatics.jax.org/searchtool/Search.do?query=CDT1&submit=Quick%0D%12024ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CDT1 rs548414653 0 0 4.521e-05 0.38 5 13 exonic exonic exonic CDT1 CDT1 ENSG00000167513 nonsynonymous SNV nonsynonymous SNV unknown CDT1:NM_030928:exon10:c.G1510C:p.E504Q, CDT1:uc002flu.3:exon10:c.G1510C:p.E504Q, UNKNOWN Het;G>C 2556;110|107 Ref Hom;G>C 4710;4|171 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89017334 89017334 C T snp nonsynonymous SNV C808T R270W polar,hydrophilic,charged(+) aromatic,hydrophobic,neutral LOC100129697 rs28617399 0 0 0.4271 1 0 0 exonic intronic exonic LOC100129697 CBFA2T3 ENSG00000205018 nonsynonymous SNV Na unknown LOC100129697:NM_001290330:exon2:c.C808T:p.R270W, Na UNKNOWN Het;C>T 232;3|9 Ref Hom;C>T 189;0|8 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89291210 89291210 G GGTGA indel frameshift substitution 118_118delinsGGTGA ZNF778 Zfp26 ENSG00000170100 zinc finger protein 778 chr16:89284118-89295363 The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011] Blood Pressure Determination Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF778 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF778&submit=Quick%0D%12632ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF778 rs10625512 0.750998 0 0.8138 1 0 0 exonic exonic exonic ZNF778 ZNF778 ENSG00000170100 frameshift substitution frameshift substitution unknown ZNF778:NM_001201407:exon5:c.328_328delinsGGTGA, ZNF778:uc002fmw.2:exon3:c.118_118delinsGGTGA,ZNF778:uc021tms.1:exon5:c.328_328delinsGGTGA, UNKNOWN Het;+GTGA 672;23|20 Het;+GTGA 666;10|17 Hom;+GTGA 1818;0|42 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89293271 89293271 A C snp nonsynonymous SNV A491C K164T polar,hydrophilic,charged(+) polar,hydrophilic,neutral ZNF778 Zfp26 ENSG00000170100 zinc finger protein 778 chr16:89284118-89295363 The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011] Blood Pressure Determination Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF778 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF778&submit=Quick%0D%12632ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF778 rs28417933 0.59405 0.7267 0.7686 0.17 2 12 exonic exonic exonic ZNF778 ZNF778 ENSG00000170100 nonsynonymous SNV nonsynonymous SNV unknown ZNF778:NM_001201407:exon7:c.A575C:p.K192T,ZNF778:NM_182531:exon6:c.A491C:p.K164T, ZNF778:uc002fmv.3:exon6:c.A491C:p.K164T,ZNF778:uc002fmw.2:exon5:c.A365C:p.K122T,ZNF778:uc021tms.1:exon7:c.A575C:p.K192T, UNKNOWN Het;A>C 2871;132|119 Het;A>C 3278;116|135 Hom;A>C 6480;0|232 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89294381 89294381 T C snp nonsynonymous SNV T1601C I534T aliphatic,hydrophobic,neutral polar,hydrophilic,neutral ZNF778 Zfp26 ENSG00000170100 zinc finger protein 778 chr16:89284118-89295363 The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011] Blood Pressure Determination Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF778 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF778&submit=Quick%0D%12632ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF778 rs28415940 0.701078 0.7822 0.8086 0.08 1 12 exonic exonic exonic ZNF778 ZNF778 ENSG00000170100 nonsynonymous SNV nonsynonymous SNV unknown ZNF778:NM_001201407:exon7:c.T1685C:p.I562T,ZNF778:NM_182531:exon6:c.T1601C:p.I534T, ZNF778:uc002fmv.3:exon6:c.T1601C:p.I534T,ZNF778:uc002fmw.2:exon5:c.T1475C:p.I492T,ZNF778:uc010vpg.2:exon6:c.T890C:p.I297T,ZNF778:uc021tms.1:exon7:c.T1685C:p.I562T, UNKNOWN Het;T>C 1592;60|65 Het;T>C 1081;62|50 Hom;T>C 4188;0|156 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89294439 89294439 G T snp nonsynonymous SNV G1659T Q553H polar,hydrophilic,neutral aromatic,polar,hydrophilic,charged(+) ZNF778 Zfp26 ENSG00000170100 zinc finger protein 778 chr16:89284118-89295363 The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011] Blood Pressure Determination Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF778 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF778&submit=Quick%0D%12632ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF778 rs9921361 0.698083 0.7807 0.8071 0.17 2 12 exonic exonic exonic ZNF778 ZNF778 ENSG00000170100 nonsynonymous SNV nonsynonymous SNV unknown ZNF778:NM_001201407:exon7:c.G1743T:p.Q581H,ZNF778:NM_182531:exon6:c.G1659T:p.Q553H, ZNF778:uc002fmv.3:exon6:c.G1659T:p.Q553H,ZNF778:uc002fmw.2:exon5:c.G1533T:p.Q511H,ZNF778:uc010vpg.2:exon6:c.G948T:p.Q316H,ZNF778:uc021tms.1:exon7:c.G1743T:p.Q581H, UNKNOWN Het;G>T 1016;37|43 Het;G>T 774;37|35 Hom;G>T 2342;0|85 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89777123 89777123 C T snp nonsynonymous SNV G1129A D377N polar,hydrophilic,charged(-) polar,hydrophilic,neutral VPS9D1 Vps9d1 ENSG00000075399 VPS9 domain containing 1 chr16:89773542-89787394 GO:0015986;ATP synthesis coupled proton transport;TAS|GO:0043547;positive regulation of GTPase activity;IEA GO:0005096;GTPase activator activity;IEA|GO:0005215;transporter activity;TAS http://www.genecards.org/index.php?path=/Search/keyword/VPS9D1 https://www.uniprot.org/uniprot/Q9Y2B5 http://www.informatics.jax.org/searchtool/Search.do?query=VPS9D1&submit=Quick%0D%1544ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=VPS9D1 rs148694296 0.00638978 0.0183 0.0256 0.75 9 12 exonic exonic exonic VPS9D1 VPS9D1 ENSG00000075399 nonsynonymous SNV nonsynonymous SNV unknown VPS9D1:NM_004913:exon10:c.G1129A:p.D377N, VPS9D1:uc002fom.1:exon10:c.G1129A:p.D377N,VPS9D1:uc002fol.1:exon9:c.G919A:p.D307N, UNKNOWN Het;C>T 2639;113|116 Ref Hom;C>T 5388;2|208 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89805914 89805914 T C snp nonsynonymous SNV A3982G T1328A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral FANCA Fanca ENSG00000187741 Fanconi anemia complementation group A chr16:89803957-89883065 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008] Adenocarcinoma|Pancreatic Neoplasms; Hair Color; epithelial ovarian cancer ; Melanosis; esophageal adenocarcinoma; Fanconi Anemia; lung cancer; Chronic renal failure|Kidney Failure, Chronic; Type 2 Diabetes| edema | rosiglitazone; breast cancer; ovarian cancer; breast cancer ; bladder cancer; breast cancer; cervical intraepithelial neoplasia grade 3; Caffeine; longevity; chronic obstructive pulmonary disease; lung cancer Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. Fanconi Anemia Pathway GO:0006281;DNA repair;TAS|GO:0006461;protein complex assembly;TAS|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007140;male meiotic nuclear division;IEA|GO:0008584;male gonad development;IEA|GO:0008585;female gonad development;IEA|GO:0036297;interstrand cross-link repair;TAS|GO:0042127;regulation of cell proliferation;IEA|GO:0045589;regulation of regulatory T cell differentiation;IEA|GO:0050727;regulation of inflammatory response;IEA|GO:0051090;regulation of sequence-specific DNA binding transcription factor activity;IEA|GO:2000348;regulation of CD40 signaling pathway;IEA GO:0005634;nucleus;TAS|GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/FANCA https://hpo.jax.org/app/browse/search?q=FANCA&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=607139 http://www.informatics.jax.org/searchtool/Search.do?query=FANCA&submit=Quick%0D%15885ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCA rs9282681 0.0722843 0.0513 0.0538 0.08 1 13 exonic exonic exonic FANCA FANCA ENSG00000187741 nonsynonymous SNV nonsynonymous SNV unknown FANCA:NM_000135:exon40:c.A3982G:p.T1328A,FANCA:NM_001286167:exon40:c.A3982G:p.T1328A, FANCA:uc002fou.1:exon40:c.A3982G:p.T1328A,FANCA:uc010vpn.1:exon40:c.A3982G:p.T1328A, UNKNOWN Het;T>C 2321;101|99 Ref Hom;T>C 4899;2|177 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89806343 89806343 C A snp nonsynonymous SNV G1251T L417F aliphatic,hydrophobic,neutral aromatic,hydrophobic,neutral FANCA Fanca ENSG00000187741 Fanconi anemia complementation group A chr16:89803957-89883065 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008] Adenocarcinoma|Pancreatic Neoplasms; Hair Color; epithelial ovarian cancer ; Melanosis; esophageal adenocarcinoma; Fanconi Anemia; lung cancer; Chronic renal failure|Kidney Failure, Chronic; Type 2 Diabetes| edema | rosiglitazone; breast cancer; ovarian cancer; breast cancer ; bladder cancer; breast cancer; cervical intraepithelial neoplasia grade 3; Caffeine; longevity; chronic obstructive pulmonary disease; lung cancer Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. Fanconi Anemia Pathway GO:0006281;DNA repair;TAS|GO:0006461;protein complex assembly;TAS|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007140;male meiotic nuclear division;IEA|GO:0008584;male gonad development;IEA|GO:0008585;female gonad development;IEA|GO:0036297;interstrand cross-link repair;TAS|GO:0042127;regulation of cell proliferation;IEA|GO:0045589;regulation of regulatory T cell differentiation;IEA|GO:0050727;regulation of inflammatory response;IEA|GO:0051090;regulation of sequence-specific DNA binding transcription factor activity;IEA|GO:2000348;regulation of CD40 signaling pathway;IEA GO:0005634;nucleus;TAS|GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/FANCA https://hpo.jax.org/app/browse/search?q=FANCA&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=607139 http://www.informatics.jax.org/searchtool/Search.do?query=FANCA&submit=Quick%0D%15885ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCA rs11647746 0.141174 0 0.1000 1 0 0 UTR3 exonic UTR3 ZNF276(NM_152287:c.*1689C>A,NM_001113525:c.*1689C>A) FANCA ENSG00000158805(ENST00000289816:c.*1689C>A) Na nonsynonymous SNV Na Na FANCA:uc010vpo.2:exon11:c.G1251T:p.L417F, Na Het;C>A 1541;90|69 Ref Hom;C>A 4742;3|180 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89815152 89815152 G A snp nonsynonymous SNV C521T S174F polar,hydrophilic,neutral aromatic,hydrophobic,neutral FANCA Fanca ENSG00000187741 Fanconi anemia complementation group A chr16:89803957-89883065 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008] Adenocarcinoma|Pancreatic Neoplasms; Hair Color; epithelial ovarian cancer ; Melanosis; esophageal adenocarcinoma; Fanconi Anemia; lung cancer; Chronic renal failure|Kidney Failure, Chronic; Type 2 Diabetes| edema | rosiglitazone; breast cancer; ovarian cancer; breast cancer ; bladder cancer; breast cancer; cervical intraepithelial neoplasia grade 3; Caffeine; longevity; chronic obstructive pulmonary disease; lung cancer Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. Fanconi Anemia Pathway GO:0006281;DNA repair;TAS|GO:0006461;protein complex assembly;TAS|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007140;male meiotic nuclear division;IEA|GO:0008584;male gonad development;IEA|GO:0008585;female gonad development;IEA|GO:0036297;interstrand cross-link repair;TAS|GO:0042127;regulation of cell proliferation;IEA|GO:0045589;regulation of regulatory T cell differentiation;IEA|GO:0050727;regulation of inflammatory response;IEA|GO:0051090;regulation of sequence-specific DNA binding transcription factor activity;IEA|GO:2000348;regulation of CD40 signaling pathway;IEA GO:0005634;nucleus;TAS|GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/FANCA https://hpo.jax.org/app/browse/search?q=FANCA&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=607139 http://www.informatics.jax.org/searchtool/Search.do?query=FANCA&submit=Quick%0D%15885ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCA rs17233497 0.0233626 0.0592 0.0510 0.54 7 13 exonic exonic exonic FANCA FANCA ENSG00000187741 nonsynonymous SNV nonsynonymous SNV unknown FANCA:NM_000135:exon33:c.C3263T:p.S1088F,FANCA:NM_001286167:exon33:c.C3263T:p.S1088F, FANCA:uc010vpo.2:exon5:c.C521T:p.S174F,FANCA:uc002fou.1:exon33:c.C3263T:p.S1088F,FANCA:uc010vpn.1:exon33:c.C3263T:p.S1088F, UNKNOWN Het;G>A 1782;78|77 Ref Hom;G>A 3616;0|128 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89839766 89839766 G C snp nonsynonymous SNV C1927G P643A hydrophobic,neutral aliphatic,hydrophobic,neutral FANCA Fanca ENSG00000187741 Fanconi anemia complementation group A chr16:89803957-89883065 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008] Adenocarcinoma|Pancreatic Neoplasms; Hair Color; epithelial ovarian cancer ; Melanosis; esophageal adenocarcinoma; Fanconi Anemia; lung cancer; Chronic renal failure|Kidney Failure, Chronic; Type 2 Diabetes| edema | rosiglitazone; breast cancer; ovarian cancer; breast cancer ; bladder cancer; breast cancer; cervical intraepithelial neoplasia grade 3; Caffeine; longevity; chronic obstructive pulmonary disease; lung cancer Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. Fanconi Anemia Pathway GO:0006281;DNA repair;TAS|GO:0006461;protein complex assembly;TAS|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007140;male meiotic nuclear division;IEA|GO:0008584;male gonad development;IEA|GO:0008585;female gonad development;IEA|GO:0036297;interstrand cross-link repair;TAS|GO:0042127;regulation of cell proliferation;IEA|GO:0045589;regulation of regulatory T cell differentiation;IEA|GO:0050727;regulation of inflammatory response;IEA|GO:0051090;regulation of sequence-specific DNA binding transcription factor activity;IEA|GO:2000348;regulation of CD40 signaling pathway;IEA GO:0005634;nucleus;TAS|GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/FANCA https://hpo.jax.org/app/browse/search?q=FANCA&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=607139 http://www.informatics.jax.org/searchtool/Search.do?query=FANCA&submit=Quick%0D%15885ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCA rs17232910 0.0740815 0.0477 0.0522 0.15 2 13 exonic exonic exonic FANCA FANCA ENSG00000187741 nonsynonymous SNV nonsynonymous SNV unknown FANCA:NM_000135:exon22:c.C1927G:p.P643A,FANCA:NM_001286167:exon22:c.C1927G:p.P643A, FANCA:uc002fou.1:exon22:c.C1927G:p.P643A,FANCA:uc010vpn.1:exon22:c.C1927G:p.P643A, UNKNOWN Het;G>C 1064;63|49 Ref Hom;G>C 3260;2|122 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89857935 89857935 G A snp nonsynonymous SNV C1235T A412V aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral FANCA Fanca ENSG00000187741 Fanconi anemia complementation group A chr16:89803957-89883065 The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008] Adenocarcinoma|Pancreatic Neoplasms; Hair Color; epithelial ovarian cancer ; Melanosis; esophageal adenocarcinoma; Fanconi Anemia; lung cancer; Chronic renal failure|Kidney Failure, Chronic; Type 2 Diabetes| edema | rosiglitazone; breast cancer; ovarian cancer; breast cancer ; bladder cancer; breast cancer; cervical intraepithelial neoplasia grade 3; Caffeine; longevity; chronic obstructive pulmonary disease; lung cancer Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. Fanconi Anemia Pathway GO:0006281;DNA repair;TAS|GO:0006461;protein complex assembly;TAS|GO:0006974;cellular response to DNA damage stimulus;IEA|GO:0007140;male meiotic nuclear division;IEA|GO:0008584;male gonad development;IEA|GO:0008585;female gonad development;IEA|GO:0036297;interstrand cross-link repair;TAS|GO:0042127;regulation of cell proliferation;IEA|GO:0045589;regulation of regulatory T cell differentiation;IEA|GO:0050727;regulation of inflammatory response;IEA|GO:0051090;regulation of sequence-specific DNA binding transcription factor activity;IEA|GO:2000348;regulation of CD40 signaling pathway;IEA GO:0005634;nucleus;TAS|GO:0005654;nucleoplasm;TAS|GO:0005737;cytoplasm;TAS|GO:0043240;Fanconi anaemia nuclear complex;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/FANCA https://hpo.jax.org/app/browse/search?q=FANCA&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=607139 http://www.informatics.jax.org/searchtool/Search.do?query=FANCA&submit=Quick%0D%15885ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FANCA rs11646374 0.0704872 0.0596 0.0651 0.54 7 13 exonic exonic exonic FANCA FANCA ENSG00000187741 nonsynonymous SNV nonsynonymous SNV unknown FANCA:NM_000135:exon14:c.C1235T:p.A412V,FANCA:NM_001286167:exon14:c.C1235T:p.A412V, FANCA:uc002fou.1:exon14:c.C1235T:p.A412V,FANCA:uc010vpn.1:exon14:c.C1235T:p.A412V, UNKNOWN Het;G>A 1177;49|54 Ref Hom;G>A 2612;0|97 16_129.974_134.474 Chr16:87933002-90108832 0.174 16 89985940 89985940 G A snp nonsynonymous SNV G274A V92M aliphatic,hydrophobic,neutral hydrophobic,neutral MC1R Mc1r ENSG00000258839 melanocortin 1 receptor chr16:89978527-89987385 This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008] vitiligo; multiple sclerosis; Carcinoma, Basal Cell; tanning; radiation, UV, sensitivity to; pigmentation; null; breast cancer melanoma; freckles; prostate cancer; Hair Color; melanoma|Skin Neoplasms; red vs non-red hair color; Brill-Symmers disease|Lymphoma, Follicular|Lymphoma, Large B-Cell, Diffuse|Lymphoma, Large-Cell, Diffuse|Neoplasms, Radiation-Induced|Skin Neoplasms; Melanosis; Adenocarcinoma, Follicular|Carcinoma, Papillary|Melanoma|Thyroid Neoplasms; human pigmentation; Suntan; Carcinoma, Basal Cell|Carcinoma, Squamous Cell|Melanoma|Skin Neoplasms; melanoma|Nevus|Skin Neoplasms|Sunburn; Heart Failure; skin cancer, non-melanoma; Vitiligo; melanoma; freckles and solar lentigines; Black vs red hair color; Skin Neoplasms; melanoma, cutaneous; Albinism, Oculocutaneous; Carcinoma, Basal Cell|Skin Basal Cell Carcinoma|Skin Neoplasms; Ocular melanoma; Photosensitivity Disorders; hair color; skin cancer, nonmelanoma; melanoma skin cancer, non-melanoma; Parkinson's disease ; Carcinoma, Basal Cell|Melanoma|Skin Neoplasms; Melanoma, Amelanotic|Skin Neoplasms; ephelides; solar lentigines; cutaneous melanoma which is largely independent of skin type and hair color; oculocutaneous albinism type 2; Dengue Hemorrhagic Fever; obesity; tanning phenotype; Epstein-Barr Virus Infections|Multiple Sclerosis; Blond vs brown hair color; vulvar vestibulitis syndrome; skin sensitivity to sun; skin cancer; squamous cell carcinoma; carcinoma, basal cell; Melanoma|Skin Neoplasms; Melanoma|Neoplasms, Multiple Primary|Nevus|Skin Neoplasms; Severe Photoaging of Facial Skin; Melanoma; Erythema|Psoriasis|Skin Neoplasms; skin color; melanoma; skin cancer, non-melanoma; Lymphoma, Non-Hodgkin; Severe Acute Radiotherapy Side Effects Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. G alpha (s) signalling events GO:0007165;signal transduction;IEA|GO:0007186;G-protein coupled receptor signaling pathway;IEA|GO:0007187;G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger;TAS|GO:0007275;multicellular organism development;TAS|GO:0009650;UV protection;TAS|GO:0010739;positive regulation of protein kinase A signaling;ISS|GO:0019233;sensory perception of pain;IEA|GO:0030819;positive regulation of cAMP biosynthetic process;IDA|GO:0032720;negative regulation of tumor necrosis factor production;IMP|GO:0035556;intracellular signal transduction;ISS|GO:0042438;melanin biosynthetic process;IEA|GO:0043473;pigmentation;TAS|GO:0045944;positive regulation of transcription from RNA polymerase II promoter;ISS|GO:0051897;positive regulation of protein kinase B signaling;ISS|GO:0070914;UV-damage excision repair;IDA|GO:0090037;positive regulation of protein kinase C signaling;ISS GO:0005622;intracellular;IEA|GO:0005886;plasma membrane;IEA|GO:0005887;integral component of plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0004871;signal transducer activity;IEA|GO:0004930;G-protein coupled receptor activity;IEA|GO:0004977;melanocortin receptor activity;IEA|GO:0004980;melanocyte-stimulating hormone receptor activity;IEA|GO:0005515;protein binding;IPI|GO:0008528;G-protein coupled peptide receptor activity;TAS|GO:0031625;ubiquitin protein ligase binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MC1R https://hpo.jax.org/app/browse/search?q=MC1R&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=155555 http://www.informatics.jax.org/searchtool/Search.do?query=MC1R&submit=Quick%0D%20304ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MC1R rs2228479 0.0796725 0.0633 0.0764 0.17 2 12 exonic exonic exonic MC1R MC1R,TUBB3 ENSG00000198211,ENSG00000258839 nonsynonymous SNV nonsynonymous SNV unknown MC1R:NM_002386:exon1:c.G274A:p.V92M, MC1R:uc002fpe.4:exon1:c.G274A:p.V92M,TUBB3:uc002fpf.2:exon1:c.G274A:p.V92M, UNKNOWN Het;G>A 2403;141|111 Ref Hom;G>A 5708;0|210 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10224526 10224526 C T snp nonsynonymous SNV C1559T P520L hydrophobic,neutral aliphatic,hydrophobic,neutral P2RY11 ENSG00000244165 purinergic receptor P2Y11 chr19:10222214-10226048 The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is coupled to the stimulation of the phosphoinositide and adenylyl cyclase pathways and behaves as a selective purinoceptor. Naturally occuring read-through transcripts, resulting from intergenic splicing between this gene and an immediately upstream gene (PPAN, encoding peter pan homolog), have been found. The PPAN-P2RY11 read-through mRNA is ubiquitously expressed and encodes a fusion protein that shares identity with each individual gene product. [provided by RefSeq, Jul 2008] Narcolepsy; myocardial infarct G alpha (s) signalling events GO:0001973;adenosine receptor signaling pathway;IEA|GO:0006952;defense response;TAS|GO:0007165;signal transduction;IEA|GO:0007186;G-protein coupled receptor signaling pathway;IDA|GO:0007190;activation of adenylate cyclase activity;TAS|GO:0007200;phospholipase C-activating G-protein coupled receptor signaling pathway;TAS|GO:0019722;calcium-mediated signaling;IDA|GO:0023041;neuronal signal transduction;IDA|GO:0035589;G-protein coupled purinergic nucleotide receptor signaling pathway;IEA|GO:0071318;cellular response to ATP;IDA GO:0005622;intracellular;IEA|GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0004871;signal transducer activity;IEA|GO:0004872;receptor activity;TAS|GO:0004930;G-protein coupled receptor activity;IEA|GO:0030594;neurotransmitter receptor activity;IDA|GO:0045028;G-protein coupled purinergic nucleotide receptor activity;IEA|GO:0045031;ATP-activated adenosine receptor activity;IDA http://www.genecards.org/index.php?path=/Search/keyword/P2RY11 https://hpo.jax.org/app/browse/search?q=P2RY11&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=602697 http://www.informatics.jax.org/searchtool/Search.do?query=P2RY11&submit=Quick%0D%19832ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=P2RY11 rs3745600 0.365415 0.3739 0.4194 0.18 2 11 exonic exonic exonic P2RY11,PPAN-P2RY11 P2RY11,PPAN-P2RY11 ENSG00000130810,ENSG00000243207,ENSG00000244165 nonsynonymous SNV nonsynonymous SNV unknown PPAN-P2RY11:NM_001198690:exon13:c.C1559T:p.P520L, PPAN-P2RY11:uc010xla.2:exon13:c.C1559T:p.P520L, UNKNOWN Het;C>T 3182;98|128 Het;C>T 1925;94|85 Hom;C>T 5332;2|188 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10229297 10229297 C A snp nonsynonymous SNV G347T R116L polar,hydrophilic,charged(+) aliphatic,hydrophobic,neutral EIF3G Eif3g ENSG00000130811 eukaryotic translation initiation factor 3 subunit G chr19:10225693-10230596 This gene encodes a core subunit of the eukaryotic translation initiation factor 3 (eIF3) complex, which is required for initiation of protein translation. An N-terminal caspase cleavage product of the encoded protein may stimulate degradation of DNA. A mutation in this gene is associated with narcolepsy. [provided by RefSeq, Jul 2016] GTP hydrolysis and joining of the 60S ribosomal subunit GO:0006412;translation;IEA|GO:0006413;translational initiation;TAS|GO:0075525;viral translational termination-reinitiation;IDA GO:0005737;cytoplasm;IDA|GO:0005829;cytosol;TAS|GO:0005852;eukaryotic translation initiation factor 3 complex;IDA|GO:0048471;perinuclear region of cytoplasm;IEA GO:0003676;nucleic acid binding;IEA|GO:0003723;RNA binding;IDA|GO:0003743;translation initiation factor activity;IEA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/EIF3G https://www.uniprot.org/uniprot/O75821 https://www.ncbi.nlm.nih.gov/omim/?term=603913 http://www.informatics.jax.org/searchtool/Search.do?query=EIF3G&submit=Quick%0D%6449ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=EIF3G rs11667630 0.377196 0.3838 0.4197 1 0 0 intronic exonic intronic EIF3G EIF3G ENSG00000130811 Na nonsynonymous SNV Na Na EIF3G:uc010dxa.3:exon5:c.G347T:p.R116L, Na Het;C>A 480;22|21 Het;C>A 149;12|9 Hom;C>A 1064;0|39 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10426659 10426659 A C snp nonsynonymous SNV T14G M5R hydrophobic,neutral polar,hydrophilic,charged(+) FDX1L Fdx1l rs201763046 0 0 1.823e-05 0.42 5 12 exonic exonic exonic FDX1L FDX1L ENSG00000167807,ENSG00000267673 nonsynonymous SNV nonsynonymous SNV unknown FDX1L:NM_001031734:exon1:c.T23G:p.M8R, FDX1L:uc002mny.1:exon1:c.T14G:p.M5R, UNKNOWN Het;A>C 1663;53|67 Het;A>C 1402;59|62 Hom;A>C 3011;0|114 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10446568 10446568 T C snp nonsynonymous SNV A428G D143G polar,hydrophilic,charged(-) aliphatic,neutral ICAM3 ENSG00000076662 intercellular adhesion molecule 3 chr19:10444452-10450499 The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016] Chronic renal failure|Kidney Failure, Chronic; Hepatitis C|Remission, Spontaneous; Birth Weight|Leukemia|Leukemia, Myeloid, Acute|Precursor Cell Lymphoblastic Leukemia-Lymphoma; Type 2 Diabetes| edema | rosiglitazone; Meningeal Neoplasms|meningioma; Arthritis, Rheumatoid|; Severe Acute Respiratory Syndrome; lactate dehydrogenase severe acute respiratory syndrome Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. CD209 (DC-SIGN) signaling GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0006909;phagocytosis;IEA|GO:0007155;cell adhesion;IEA|GO:0016337;single organismal cell-cell adhesion;IEA|GO:0030198;extracellular matrix organization;TAS|GO:0050776;regulation of immune response;TAS GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005102;receptor binding;TAS|GO:0005178;integrin binding;TAS|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/ICAM3 https://www.uniprot.org/uniprot/P32942 https://www.ncbi.nlm.nih.gov/omim/?term=146631 http://www.informatics.jax.org/searchtool/Search.do?query=ICAM3&submit=Quick%0D%1591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ICAM3 rs2304237 0.179513 0.2018 0.2700 0.15 2 13 exonic exonic exonic ICAM3 ICAM3 ENSG00000076662 nonsynonymous SNV nonsynonymous SNV unknown ICAM3:NM_002162:exon3:c.A428G:p.D143G, ICAM3:uc002mob.2:exon3:c.A428G:p.D143G,ICAM3:uc010xlf.1:exon3:c.A197G:p.D66G,ICAM3:uc010dxd.1:exon3:c.A197G:p.D66G, UNKNOWN Het;T>C 702;54|33 Het;T>C 1151;54|47 Hom;T>C 1512;2|57 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10449358 10449358 T C snp nonsynonymous SNV A343G R115G polar,hydrophilic,charged(+) aliphatic,neutral ICAM3 ENSG00000076662 intercellular adhesion molecule 3 chr19:10444452-10450499 The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016] Chronic renal failure|Kidney Failure, Chronic; Hepatitis C|Remission, Spontaneous; Birth Weight|Leukemia|Leukemia, Myeloid, Acute|Precursor Cell Lymphoblastic Leukemia-Lymphoma; Type 2 Diabetes| edema | rosiglitazone; Meningeal Neoplasms|meningioma; Arthritis, Rheumatoid|; Severe Acute Respiratory Syndrome; lactate dehydrogenase severe acute respiratory syndrome Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. CD209 (DC-SIGN) signaling GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0006909;phagocytosis;IEA|GO:0007155;cell adhesion;IEA|GO:0016337;single organismal cell-cell adhesion;IEA|GO:0030198;extracellular matrix organization;TAS|GO:0050776;regulation of immune response;TAS GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005102;receptor binding;TAS|GO:0005178;integrin binding;TAS|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/ICAM3 https://www.uniprot.org/uniprot/P32942 https://www.ncbi.nlm.nih.gov/omim/?term=146631 http://www.informatics.jax.org/searchtool/Search.do?query=ICAM3&submit=Quick%0D%1591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ICAM3 rs7258015 0.178914 0.2085 0.2188 0.08 1 13 exonic exonic exonic ICAM3 ICAM3 ENSG00000076662 nonsynonymous SNV nonsynonymous SNV unknown ICAM3:NM_002162:exon2:c.A343G:p.R115G, ICAM3:uc002mob.2:exon2:c.A343G:p.R115G,ICAM3:uc010xlf.1:exon2:c.A112G:p.R38G,ICAM3:uc010dxd.1:exon2:c.A112G:p.R38G, UNKNOWN Het;T>C 999;81|48 Het;T>C 1324;60|59 Hom;T>C 2841;0|99 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10670992 10670992 C T snp nonsynonymous SNV G814A E272K polar,hydrophilic,charged(-) polar,hydrophilic,charged(+) KRI1 Kri1 ENSG00000129347 KRI1 homolog chr19:10663761-10676713 This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008] Celiac Disease|; Waist Circumference GO:0000447;endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA);IBA GO:0005730;nucleolus;IDA|GO:0030686;90S preribosome;IBA GO:0003723;RNA binding;IDA http://www.genecards.org/index.php?path=/Search/keyword/KRI1 https://www.uniprot.org/uniprot/Q8N9T8 http://www.informatics.jax.org/searchtool/Search.do?query=KRI1&submit=Quick%0D%6241ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KRI1 rs3745249 0.321086 0.3819 0.4368 0.08 1 13 exonic exonic exonic KRI1 KRI1 ENSG00000129347 nonsynonymous SNV nonsynonymous SNV unknown KRI1:NM_023008:exon9:c.G814A:p.E272K, KRI1:uc002moy.1:exon9:c.G814A:p.E272K,KRI1:uc002mox.1:exon8:c.G802A:p.E268K, UNKNOWN Het;C>T 969;48|45 Het;C>T 981;31|45 Hom;C>T 2204;2|84 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10672493 10672493 C T snp nonsynonymous SNV G430A G144R aliphatic,neutral polar,hydrophilic,charged(+) KRI1 Kri1 ENSG00000129347 KRI1 homolog chr19:10663761-10676713 This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008] Celiac Disease|; Waist Circumference GO:0000447;endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA);IBA GO:0005730;nucleolus;IDA|GO:0030686;90S preribosome;IBA GO:0003723;RNA binding;IDA http://www.genecards.org/index.php?path=/Search/keyword/KRI1 https://www.uniprot.org/uniprot/Q8N9T8 http://www.informatics.jax.org/searchtool/Search.do?query=KRI1&submit=Quick%0D%6241ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KRI1 rs12984043 0.261581 0.3092 0.3376 0.15 2 13 exonic exonic exonic KRI1 KRI1 ENSG00000129347 nonsynonymous SNV nonsynonymous SNV unknown KRI1:NM_023008:exon5:c.G430A:p.G144R, KRI1:uc002moy.1:exon5:c.G430A:p.G144R,KRI1:uc002mox.1:exon4:c.G418A:p.G140R, UNKNOWN Het;C>T 760;39|44 Het;C>T 1015;29|43 Hom;C>T 2013;0|79 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 10676681 10676681 T C snp nonsynonymous SNV A13G T5A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral KRI1 Kri1 ENSG00000129347 KRI1 homolog chr19:10663761-10676713 This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008] Celiac Disease|; Waist Circumference GO:0000447;endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA);IBA GO:0005730;nucleolus;IDA|GO:0030686;90S preribosome;IBA GO:0003723;RNA binding;IDA http://www.genecards.org/index.php?path=/Search/keyword/KRI1 https://www.uniprot.org/uniprot/Q8N9T8 http://www.informatics.jax.org/searchtool/Search.do?query=KRI1&submit=Quick%0D%6241ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KRI1 rs3218222 0.604233 0.8028 0.6128 0.15 2 13 exonic exonic exonic KRI1 KRI1 ENSG00000129347 nonsynonymous SNV nonsynonymous SNV unknown KRI1:NM_023008:exon1:c.A13G:p.T5A, KRI1:uc002moy.1:exon1:c.A13G:p.T5A, UNKNOWN Het;T>C 1460;62|66 Het;T>C 734;57|38 Hom;T>C 2789;0|100 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 11833891 11833891 G C snp nonsynonymous SNV C458G T153R polar,hydrophilic,neutral polar,hydrophilic,charged(+) ZNF823 ENSG00000197933 zinc finger protein 823 chr19:11832080-11849824 Blood Pressure GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF823 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF823&submit=Quick%0D%16758ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF823 rs117644723 0.00838658 0.0074 0.0090 0.17 2 12 exonic exonic exonic ZNF823 ZNF823 ENSG00000197933 nonsynonymous SNV nonsynonymous SNV unknown ZNF823:NM_001080493:exon4:c.C458G:p.T153R,ZNF823:NM_017507:exon3:c.C326G:p.T109R, ZNF823:uc002msm.2:exon4:c.C458G:p.T153R,ZNF823:uc010dyi.1:exon3:c.C326G:p.T109R, UNKNOWN Het;G>C 1469;99|69 Het;G>C 1460;90|60 Hom;G>C 3769;2|135 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 11941221 11941221 T A snp nonsynonymous SNV T127A L43I aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral ZNF440 ENSG00000171295 zinc finger protein 440 chr19:11925099-11946016 Tobacco Use Disorder Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF440 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF440&submit=Quick%0D%12893ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF440 rs424132 0.321286 0 0.3459 0.08 1 12 exonic exonic exonic ZNF440 ZNF440 ENSG00000171295 nonsynonymous SNV nonsynonymous SNV unknown ZNF440:NM_152357:exon2:c.T127A:p.L43I, ZNF440:uc002msp.1:exon2:c.T127A:p.L43I, UNKNOWN Het;T>A 462;8|20 Het;T>A 89;12|6 Hom;T>A 543;0|21 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 11942362 11942362 A G snp nonsynonymous SNV A371G N124S polar,hydrophilic,neutral polar,hydrophilic,neutral ZNF440 ENSG00000171295 zinc finger protein 440 chr19:11925099-11946016 Tobacco Use Disorder Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF440 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF440&submit=Quick%0D%12893ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF440 rs427880 0.535942 0.5538 0.4454 0.08 1 12 exonic exonic exonic ZNF440 ZNF440 ENSG00000171295 nonsynonymous SNV nonsynonymous SNV unknown ZNF440:NM_152357:exon4:c.A371G:p.N124S, ZNF440:uc002msp.1:exon4:c.A371G:p.N124S, UNKNOWN Het;A>G 550;7|19 Het;A>G 740;20|26 Hom;A>G 1057;0|36 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12187151 12187151 C G snp nonsynonymous SNV C1216G P406A hydrophobic,neutral aliphatic,hydrophobic,neutral ZNF844 ENSG00000223547 zinc finger protein 844 chr19:12175514-12192380 GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0005515;protein binding;IPI|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF844 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF844&submit=Quick%0D%18483ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF844 rs146604057 0.0113818 0.0096 0.0147 0.00 0 12 exonic exonic exonic ZNF844 ZNF844 ENSG00000223547 nonsynonymous SNV nonsynonymous SNV unknown ZNF844:NM_001136501:exon4:c.C1216G:p.P406A, ZNF844:uc002mtb.2:exon4:c.C1216G:p.P406A,ZNF844:uc010dym.1:exon3:c.C745G:p.P249A, UNKNOWN Het;C>G 546;7|18 Het;C>G 100;11|5 Hom;C>G 695;0|18 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12541214 12541214 G T snp nonsynonymous SNV C1772A P591Q hydrophobic,neutral polar,hydrophilic,neutral ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs7256321 0.391174 0.3392 0.3211 0.08 1 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon4:c.C1772A:p.P591Q, ZNF443:uc002mtu.3:exon4:c.C1772A:p.P591Q, UNKNOWN Het;G>T 724;47|38 Het;G>T 911;55|43 Hom;G>T 2529;0|96 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12541542 12541542 C T snp nonsynonymous SNV G1444A G482R aliphatic,neutral polar,hydrophilic,charged(+) ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs34507016 0.390974 0.2728 0.2692 0.58 7 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon4:c.G1444A:p.G482R, ZNF443:uc002mtu.3:exon4:c.G1444A:p.G482R, UNKNOWN Het;C>T 108;7|2 Ref Hom;C>T 467;0|11 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12541544 12541544 A C snp nonsynonymous SNV T1442G L481R aliphatic,hydrophobic,neutral polar,hydrophilic,charged(+) ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs35055629 0.391174 0.2748 0.2896 0.08 1 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon4:c.T1442G:p.L481R, ZNF443:uc002mtu.3:exon4:c.T1442G:p.L481R, UNKNOWN Het;A>C 35;7|2 Ref Hom;A>C 467;0|11 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12542653 12542653 T G snp nonsynonymous SNV A333C K111N polar,hydrophilic,charged(+) polar,hydrophilic,neutral ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs4239550 0.390176 0.3368 0.3209 0.08 1 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon4:c.A333C:p.K111N, ZNF443:uc002mtu.3:exon4:c.A333C:p.K111N, UNKNOWN Het;T>G 2053;62|54 Het;T>G 3475;80|91 Hom;T>G 7380;0|167 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12542654 12542654 T A snp nonsynonymous SNV A332T K111I polar,hydrophilic,charged(+) aliphatic,hydrophobic,neutral ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs28599549 0.390176 0.3365 0.3208 0.08 1 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon4:c.A332T:p.K111I, ZNF443:uc002mtu.3:exon4:c.A332T:p.K111I, UNKNOWN Het;T>A 2053;62|54 Het;T>A 3475;78|89 Hom;T>A 7380;0|164 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 12543251 12543251 A C snp nonsynonymous SNV T131G V44G aliphatic,hydrophobic,neutral aliphatic,neutral ZNF443 Zfp709 ENSG00000180855 zinc finger protein 443 chr19:12540521-12551926 Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002] Generic Transcription Pathway GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;TAS|GO:0006950;response to stress;TAS GO:0005622;intracellular;IEA|GO:0005634;nucleus;IEA GO:0003676;nucleic acid binding;IEA|GO:0003677;DNA binding;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/ZNF443 https://www.ncbi.nlm.nih.gov/omim/?term=606697 http://www.informatics.jax.org/searchtool/Search.do?query=ZNF443&submit=Quick%0D%14535ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ZNF443 rs62114866 0 0 0.2127 0.00 0 12 exonic exonic exonic ZNF443 ZNF443 ENSG00000180855 nonsynonymous SNV nonsynonymous SNV unknown ZNF443:NM_005815:exon3:c.T131G:p.V44G, ZNF443:uc002mtu.3:exon3:c.T131G:p.V44G, UNKNOWN Het;A>C 644;51|27 Het;A>C 488;77|28 Hom;A>C 1588;1|50 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 14040896 14040896 G A snp nonsynonymous SNV G2716A A906T aliphatic,hydrophobic,neutral polar,hydrophilic,neutral CC2D1A Cc2d1a ENSG00000132024 coiled-coil and C2 domain containing 1A chr19:14017014-14041692 This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009] Macular Degeneration Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. GO:0000122;negative regulation of transcription from RNA polymerase II promoter;IEA|GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0007165;signal transduction;IEA|GO:0043123;positive regulation of I-kappaB kinase/NF-kappaB signaling;IMP GO:0001650;fibrillar center;IDA|GO:0005634;nucleus;IEA|GO:0005737;cytoplasm;IEA|GO:0005815;microtubule organizing center;IEA|GO:0005829;cytosol;IDA|GO:0005856;cytoskeleton;IEA|GO:0005886;plasma membrane;IDA|GO:0016020;membrane;IDA|GO:0070062;extracellular exosome;IDA GO:0000978;RNA polymerase II core promoter proximal region sequence-specific DNA binding;IEA|GO:0000981;RNA polymerase II transcription factor activity, sequence-specific DNA binding;IBA|GO:0001078;transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding;IEA|GO:0003677;DNA binding;IEA|GO:0004871;signal transducer activity;IMP|GO:0005515;protein binding;IPI|GO:0045296;cadherin binding;IDA http://www.genecards.org/index.php?path=/Search/keyword/CC2D1A https://www.uniprot.org/uniprot/Q6P1N0 https://hpo.jax.org/app/browse/search?q=CC2D1A&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=610055 http://www.informatics.jax.org/searchtool/Search.do?query=CC2D1A&submit=Quick%0D%6621ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CC2D1A rs11669628 0.133187 0.0959 0.1385 0.08 1 13 exonic exonic exonic CC2D1A CC2D1A ENSG00000132024 nonsynonymous SNV nonsynonymous SNV unknown CC2D1A:NM_017721:exon27:c.G2716A:p.A906T, CC2D1A:uc002mxo.2:exon27:c.G2716A:p.A906T,CC2D1A:uc010dzh.2:exon22:c.G1423A:p.A475T,CC2D1A:uc002mxp.2:exon27:c.G2713A:p.A905T, UNKNOWN Het;G>A 619;32|27 Het;G>A 963;18|39 Hom;G>A 1575;0|59 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 14153293 14153293 T C snp nonsynonymous SNV T563C L188P aliphatic,hydrophobic,neutral hydrophobic,neutral IL27RA Il27ra ENSG00000104998 interleukin 27 receptor subunit alpha chr19:14142560-14163743 In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008] Bronchiolitis, Viral|Respiratory Syncytial Virus Infections; respiratory syncytial virus bronchiolitis; Asthma|Bronchiolitis, Viral|Respiratory Syncytial Virus Infections T helper 1 response and responses to parasitic and bacterial infection are altered in homozygous mutant mice. Interleukin-12 family signaling GO:0002827;positive regulation of T-helper 1 type immune response;IEA|GO:0002829;negative regulation of type 2 immune response;IEA|GO:0006955;immune response;TAS|GO:0007166;cell surface receptor signaling pathway;TAS|GO:0032729;positive regulation of interferon-gamma production;IEA|GO:0048302;regulation of isotype switching to IgG isotypes;IEA|GO:0050830;defense response to Gram-positive bacterium;IEA|GO:0070106;interleukin-27-mediated signaling pathway;IEA GO:0005886;plasma membrane;TAS|GO:0005887;integral component of plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0004888;transmembrane signaling receptor activity;TAS|GO:0045509;interleukin-27 receptor activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/IL27RA https://www.uniprot.org/uniprot/Q6UWB1 https://www.ncbi.nlm.nih.gov/omim/?term=605350 http://www.informatics.jax.org/searchtool/Search.do?query=IL27RA&submit=Quick%0D%3224ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=IL27RA rs35026308 0.141773 0.1382 0.1625 0.23 3 13 exonic exonic exonic IL27RA IL27RA ENSG00000104998 nonsynonymous SNV nonsynonymous SNV unknown IL27RA:NM_004843:exon5:c.T563C:p.L188P, IL27RA:uc002mxx.4:exon5:c.T563C:p.L188P, UNKNOWN Het;T>C 2537;135|123 Het;T>C 2061;110|101 Hom;T>C 5920;0|225 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 14862430 14862430 C G snp nonsynonymous SNV G1842C L614F aliphatic,hydrophobic,neutral aromatic,hydrophobic,neutral EMR2 rs2524383 0.816494 0.7703 0.7371 0.17 2 12 exonic exonic exonic ADGRE2 EMR2 ENSG00000127507 nonsynonymous SNV nonsynonymous SNV unknown ADGRE2:NM_013447:exon16:c.G1842C:p.L614F,ADGRE2:NM_001271052:exon14:c.G1668C:p.L556F, EMR2:uc002mzp.2:exon16:c.G1842C:p.L614F,EMR2:uc031rjt.1:exon15:c.G1842C:p.L614F,EMR2:uc031rju.1:exon15:c.G1809C:p.L603F,EMR2:uc010xnw.2:exon14:c.G1668C:p.L556F,EMR2:uc010dzs.2:exon6:c.G219C:p.L73F,EMR2:uc010xnx.2:exon10:c.G273C:p.L91F,EMR2:uc031rjs.1:exon10:c.G1026C:p.L342F, UNKNOWN Het;C>G 2524;123|102 Het;C>G 1891;107|78 Hom;C>G 5307;0|197 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 14991507 14991507 T C snp nonsynonymous SNV A661G I221V aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral OR7A17 Olfr19 ENSG00000185385 olfactory receptor family 7 subfamily A member 17 chr19:14991138-14992264 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] Olfactory Signaling Pathway GO:0007165;signal transduction;IEA|GO:0007186;G-protein coupled receptor signaling pathway;IBA|GO:0007608;sensory perception of smell;IEA|GO:0050896;response to stimulus;IEA|GO:0050911;detection of chemical stimulus involved in sensory perception of smell;IBA GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IBA GO:0004871;signal transducer activity;IEA|GO:0004930;G-protein coupled receptor activity;IEA|GO:0004984;olfactory receptor activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/OR7A17 http://www.informatics.jax.org/searchtool/Search.do?query=OR7A17&submit=Quick%0D%15408ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OR7A17 rs112660270 0.000399361 0.0003 0.0007 0.50 6 12 exonic exonic exonic OR7A17 OR7A17 ENSG00000185385 nonsynonymous SNV nonsynonymous SNV unknown OR7A17:NM_030901:exon1:c.A661G:p.I221V, OR7A17:uc010xob.2:exon1:c.A661G:p.I221V, UNKNOWN Het;T>C 92;8|4 Het;T>C 292;8|9 Hom;T>C 177;0|5 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 6736607 6736607 A G snp nonsynonymous SNV T236C L79P aliphatic,hydrophobic,neutral hydrophobic,neutral GPR108 Gpr108 ENSG00000125734 G protein-coupled receptor 108 chr19:6729925-6737614 Meningeal Neoplasms|meningioma; Birth Weight|Leukemia|Leukemia, Myeloid, Acute|Precursor Cell Lymphoblastic Leukemia-Lymphoma Mice homozygous for a null allele exhibit increased LPS-induced mortality. GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA http://www.genecards.org/index.php?path=/Search/keyword/GPR108 https://www.uniprot.org/uniprot/Q9NPR9 http://www.informatics.jax.org/searchtool/Search.do?query=GPR108&submit=Quick%0D%5821ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=GPR108 rs4807897 0.0091853 0.0086 0.0128 0.00 0 13 exonic exonic exonic GPR108 GPR108 ENSG00000125734 nonsynonymous SNV nonsynonymous SNV unknown GPR108:NM_001080452:exon2:c.T236C:p.L79P, GPR108:uc002mfp.3:exon2:c.T236C:p.L79P, UNKNOWN Het;A>G 703;29|31 Het;A>G 603;34|28 Hom;A>G 2459;0|89 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 6744953 6744953 G A snp nonsynonymous SNV G932A R311Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral TRIP10 Trip10 ENSG00000125733 thyroid hormone receptor interactor 10 chr19:6737936-6751537 Mice homozygous for a knock-out allele exhibit increased insulin-stimulated glucose uptake in adipocytes and decreased circulating glucose levels. Mice homozygous for another knock-out allele exhibit impaired integrin-dependent T-cell trafficking. Clathrin-mediated endocytosis GO:0006897;endocytosis;IEA|GO:0007154;cell communication;NAS|GO:0007165;signal transduction;TAS|GO:0030036;actin cytoskeleton organization;IEA|GO:0043547;positive regulation of GTPase activity;IEA|GO:0051056;regulation of small GTPase mediated signal transduction;TAS|GO:0061024;membrane organization;TAS GO:0001891;phagocytic cup;IEA|GO:0005654;nucleoplasm;IDA|GO:0005737;cytoplasm;IEA|GO:0005764;lysosome;IEA|GO:0005794;Golgi apparatus;IEA|GO:0005829;cytosol;TAS|GO:0005856;cytoskeleton;IEA|GO:0005886;plasma membrane;IEA|GO:0005938;cell cortex;IEA|GO:0016020;membrane;IEA|GO:0042995;cell projection;IEA|GO:0043231;intracellular membrane-bounded organelle;IDA|GO:0048471;perinuclear region of cytoplasm;IEA|GO:0070062;extracellular exosome;IDA GO:0005096;GTPase activator activity;TAS|GO:0005515;protein binding;IPI|GO:0008289;lipid binding;IEA|GO:0042802;identical protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/TRIP10 https://www.uniprot.org/uniprot/Q15642 https://www.ncbi.nlm.nih.gov/omim/?term=604504 http://www.informatics.jax.org/searchtool/Search.do?query=TRIP10&submit=Quick%0D%5820ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TRIP10 rs148404026 0 7.7e-05 0.0001 0.46 6 13 exonic exonic exonic TRIP10 TRIP10 ENSG00000125733 nonsynonymous SNV nonsynonymous SNV unknown TRIP10:NM_001288963:exon9:c.G932A:p.R311Q,TRIP10:NM_001288962:exon9:c.G932A:p.R311Q,TRIP10:NM_004240:exon9:c.G932A:p.R311Q, TRIP10:uc002mfr.3:exon9:c.G932A:p.R311Q,TRIP10:uc002mfs.3:exon9:c.G932A:p.R311Q,TRIP10:uc010dux.2:exon9:c.G932A:p.R311Q, UNKNOWN Het;G>A 1386;75|65 Het;G>A 1060;76|53 Hom;G>A 3107;2|123 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 6926378 6926378 T C snp nonsynonymous SNV T1457C M486T hydrophobic,neutral polar,hydrophilic,neutral EMR1 rs2228539 0.319688 0.3793 0.2768 0.25 3 12 exonic exonic exonic ADGRE1 EMR1 ENSG00000174837 nonsynonymous SNV nonsynonymous SNV unknown ADGRE1:NM_001256252:exon15:c.T1832C:p.M611T,ADGRE1:NM_001256254:exon13:c.T1565C:p.M522T,ADGRE1:NM_001256253:exon15:c.T1793C:p.M598T,ADGRE1:NM_001974:exon16:c.T1988C:p.M663T,ADGRE1:NM_001256255:exon13:c.T1457C:p.M486T, EMR1:uc010xjj.3:exon13:c.T1457C:p.M486T,EMR1:uc010dvb.4:exon15:c.T1832C:p.M611T,EMR1:uc002mfw.4:exon16:c.T1988C:p.M663T,EMR1:uc010dvc.4:exon15:c.T1793C:p.M598T,EMR1:uc010xji.3:exon13:c.T1565C:p.M522T, UNKNOWN Het;T>C 729;26|22 Het;T>C 825;10|22 Hom;T>C 1535;0|40 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 7537808 7537808 G A snp nonsynonymous SNV C440T S147L polar,hydrophilic,neutral aliphatic,hydrophobic,neutral LOC100128573 Na 0 0 0 1 0 0 ncRNA_exonic exonic downstream LOC100128573 LOC100128573 ENSG00000104880 Na nonsynonymous SNV Na Na LOC100128573:uc010xjn.2:exon1:c.C440T:p.S147L, Na Het;G>A 214;13|9 Het;G>A 150;7|8 Hom;G>A 460;0|17 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 8121360 8121360 A G snp nonsynonymous SNV A302G H101R aromatic,polar,hydrophilic,charged(+) polar,hydrophilic,charged(+) CCL25 Ccl25 ENSG00000131142 C-C motif chemokine ligand 25 chr19:8117651-8127534 This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Hyperparathyroidism, Secondary; respiratory syncytial virus bronchiolitis; Asthma|Bronchiolitis, Viral|Respiratory Syncytial Virus Infections; Bronchiolitis, Viral|Respiratory Syncytial Virus Infections Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. G alpha (i) signalling events GO:0001954;positive regulation of cell-matrix adhesion;IDA|GO:0002548;monocyte chemotaxis;IBA|GO:0006935;chemotaxis;TAS|GO:0006954;inflammatory response;IEA|GO:0006955;immune response;TAS|GO:0007166;cell surface receptor signaling pathway;TAS|GO:0007186;G-protein coupled receptor signaling pathway;IDA|GO:0030593;neutrophil chemotaxis;IBA|GO:0043547;positive regulation of GTPase activity;IBA|GO:0048247;lymphocyte chemotaxis;IBA|GO:0050900;leukocyte migration;IEA|GO:0060326;cell chemotaxis;IDA|GO:0070098;chemokine-mediated signaling pathway;IBA|GO:0070374;positive regulation of ERK1 and ERK2 cascade;IBA|GO:0071346;cellular response to interferon-gamma;IBA|GO:0071347;cellular response to interleukin-1;IBA|GO:0071356;cellular response to tumor necrosis factor;IBA|GO:1903237;negative regulation of leukocyte tethering or rolling;IDA GO:0005576;extracellular region;TAS|GO:0005615;extracellular space;IEA GO:0005125;cytokine activity;IEA|GO:0005179;hormone activity;TAS|GO:0008009;chemokine activity;IDA|GO:0031735;CCR10 chemokine receptor binding;IDA|GO:0042379;chemokine receptor binding;IDA http://www.genecards.org/index.php?path=/Search/keyword/CCL25 https://www.uniprot.org/uniprot/O15444 https://www.ncbi.nlm.nih.gov/omim/?term=602565 http://www.informatics.jax.org/searchtool/Search.do?query=CCL25&submit=Quick%0D%6502ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CCL25 rs2032887 0.217652 0.2446 0.2323 0.08 1 13 exonic exonic exonic CCL25 CCL25 ENSG00000131142 nonsynonymous SNV nonsynonymous SNV unknown CCL25:NM_005624:exon4:c.A302G:p.H101R,CCL25:NM_001201359:exon4:c.A302G:p.H101R, CCL25:uc002mjc.4:exon4:c.A302G:p.H101R,CCL25:uc002mjd.3:exon4:c.A302G:p.H101R, UNKNOWN Het;A>G 481;46|24 Het;A>G 511;24|25 Hom;A>G 1404;0|46 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 8138054 8138054 C A snp nonsynonymous SNV G7830T E2610D polar,hydrophilic,charged(-) polar,hydrophilic,charged(-) FBN3 ENSG00000142449 fibrillin 3 chr19:8130286-8214730 This gene encodes a memebr of the fibrillin protein family. Fibrillins are extracellular matrix molecules that assemble into microfibrils in many connective tissues. This gene is most highly expressed in fetal tissues and its protein product is localized to extracellular microfibrils of developing skeletal elements, skin, lung, kidney, and skeletal muscle. This gene is potentially involved in Weill-Marchesani syndrome. [provided by RefSeq, Mar 2016] Polycystic Ovary Syndrome; POLYCYSTIC OVARIAN SYNDROME|Polycystic Ovary Syndrome; Fibrinogen; Sphingomyelins; Scoliosis; Sphingolipids; Insulin Resistance|POLYCYSTIC OVARIAN SYNDROME|Polycystic Ovary Syndrome; Forced Expiratory Volume; Hypertension Molecules associated with elastic fibres GO:0009653;anatomical structure morphogenesis;IBA|GO:0090287;regulation of cellular response to growth factor stimulus;IBA GO:0005576;extracellular region;IEA|GO:0005578;proteinaceous extracellular matrix;IEA|GO:0031012;extracellular matrix;IBA GO:0005201;extracellular matrix structural constituent;IBA|GO:0005509;calcium ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/FBN3 https://www.uniprot.org/uniprot/Q75N90 https://www.ncbi.nlm.nih.gov/omim/?term=608529 http://www.informatics.jax.org/searchtool/Search.do?query=FBN3&submit=Quick%0D%8283ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=FBN3 rs7257948 0.579473 0.6438 0.5465 0.15 2 13 exonic exonic exonic FBN3 FBN3 ENSG00000142449 nonsynonymous SNV nonsynonymous SNV unknown FBN3:NM_032447:exon61:c.G7830T:p.E2610D, FBN3:uc002mjf.3:exon61:c.G7830T:p.E2610D,FBN3:uc002mje.3:exon12:c.G1218T:p.E406D, UNKNOWN Het;C>A 1159;64|60 Het;C>A 784;55|40 Hom;C>A 2900;0|110 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 8503345 8503345 G C snp nonsynonymous SNV G656C R219P polar,hydrophilic,charged(+) hydrophobic,neutral MARCH2 March2 ENSG00000099785 membrane associated ring-CH-type finger 2 chr19:8478154-8503901 MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]).[supplied by OMIM, Mar 2010] GO:0006897;endocytosis;IEA|GO:0016567;protein ubiquitination;IDA GO:0005764;lysosome;IEA|GO:0005765;lysosomal membrane;IEA|GO:0005768;endosome;IEA|GO:0005783;endoplasmic reticulum;IDA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0010008;endosome membrane;IEA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0031410;cytoplasmic vesicle;IDA GO:0004842;ubiquitin-protein transferase activity;IDA|GO:0005515;protein binding;IPI|GO:0008270;zinc ion binding;IEA|GO:0016740;transferase activity;IEA|GO:0046872;metal ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/MARCH2 https://www.uniprot.org/uniprot/Q9P0N8 https://www.ncbi.nlm.nih.gov/omim/?term=613332 http://www.informatics.jax.org/searchtool/Search.do?query=MARCH2&submit=Quick%0D%2329ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MARCH2 rs34099346 0.0934505 0.1049 0.1551 0.15 2 13 exonic exonic exonic MARCH2 MARCH2 ENSG00000099785 nonsynonymous SNV nonsynonymous SNV unknown MARCH2:NM_001005416:exon4:c.G446C:p.R149P,MARCH2:NM_001005415:exon5:c.G656C:p.R219P,MARCH2:NM_016496:exon6:c.G656C:p.R219P, MARCH2:uc002mjv.3:exon6:c.G656C:p.R219P,MARCH2:uc002mjx.3:exon4:c.G446C:p.R149P,MARCH2:uc002mjw.3:exon5:c.G656C:p.R219P, UNKNOWN Het;G>C 2124;102|94 Het;G>C 1537;102|77 Hom;G>C 4815;0|182 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9068374 9068374 A G snp nonsynonymous SNV T19072C S6358P polar,hydrophilic,neutral hydrophobic,neutral MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs61732552 0.0181709 0.0224 0.0286 0.08 1 12 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon3:c.T19072C:p.S6358P, MUC16:uc002mkp.3:exon3:c.T19072C:p.S6358P, UNKNOWN Het;A>G 2278;73|92 Het;A>G 2127;100|92 Hom;A>G 5284;0|183 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9071562 9071562 C T snp nonsynonymous SNV G15884A G5295E aliphatic,neutral polar,hydrophilic,charged(-) MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs116866749 0.0169728 0.0221 0.0272 0.08 1 12 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon3:c.G15884A:p.G5295E, MUC16:uc002mkp.3:exon3:c.G15884A:p.G5295E, UNKNOWN Het;C>T 1585;83|73 Het;C>T 1547;98|68 Hom;C>T 4116;0|149 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9083143 9083143 G A snp nonsynonymous SNV C8672T T2891I polar,hydrophilic,neutral aliphatic,hydrophobic,neutral MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs7245949 0.226438 0.3097 0.2933 0.33 4 12 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.C8672T:p.T2891I, MUC16:uc002mkp.3:exon1:c.C8672T:p.T2891I, UNKNOWN Het;G>A 1471;77|66 Het;G>A 1648;79|75 Hom;G>A 3441;0|121 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9083174 9083174 G A snp nonsynonymous SNV C8641T P2881S hydrophobic,neutral polar,hydrophilic,neutral MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs7245960 0.226637 0.3087 0.2948 0.17 2 12 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.C8641T:p.P2881S, MUC16:uc002mkp.3:exon1:c.C8641T:p.P2881S, UNKNOWN Het;G>A 1644;78|69 Het;G>A 1549;80|63 Hom;G>A 3269;0|112 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9084299 9084299 T C snp nonsynonymous SNV A7516G T2506A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs1609458 0.416733 0.4530 0.4880 0.30 3 10 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.A7516G:p.T2506A, MUC16:uc002mkp.3:exon1:c.A7516G:p.T2506A, UNKNOWN Het;T>C 1488;50|62 Het;T>C 1485;40|56 Hom;T>C 3134;0|106 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9084481 9084481 C T snp nonsynonymous SNV G7334A G2445D aliphatic,neutral polar,hydrophilic,charged(-) MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs28641623 0.0225639 0.0233 0.0069 0.27 3 11 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.G7334A:p.G2445D, MUC16:uc002mkp.3:exon1:c.G7334A:p.G2445D, UNKNOWN Het;C>T 1256;43|52 Het;C>T 1638;34|65 Hom;C>T 3168;1|112 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9086123 9086123 A C snp nonsynonymous SNV T5692G Y1898D aromatic,polar,hydrophobic polar,hydrophilic,charged(-) MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs10402812 0.226438 0.3095 0.2920 0.30 3 10 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.T5692G:p.Y1898D, MUC16:uc002mkp.3:exon1:c.T5692G:p.Y1898D, UNKNOWN Het;A>C 1325;69|55 Het;A>C 1219;81|57 Hom;A>C 3723;0|130 19_20.212_38.212 Chr19:6565245-15124834 0.429 19 9088017 9088017 T G snp nonsynonymous SNV A3798C K1266N polar,hydrophilic,charged(+) polar,hydrophilic,neutral MUC16 Muc16 ENSG00000181143 mucin 16, cell surface associated chr19:8959520-9092018 Heart Failure; epithelial ovarian cancer Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. Termination of O-glycan biosynthesis GO:0002223;stimulatory C-type lectin receptor signaling pathway;TAS|GO:0007155;cell adhesion;NAS|GO:0016266;O-glycan processing;TAS GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IEA|GO:0005796;Golgi lumen;TAS|GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0019898;extrinsic component of membrane;IDA|GO:0031982;vesicle;IDA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/MUC16 https://www.ncbi.nlm.nih.gov/omim/?term=606154 http://www.informatics.jax.org/searchtool/Search.do?query=MUC16&submit=Quick%0D%14587ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MUC16 rs1596797 0.796326 0.7692 0.7434 0.08 1 12 exonic exonic exonic MUC16 MUC16 ENSG00000181143 nonsynonymous SNV nonsynonymous SNV unknown MUC16:NM_024690:exon1:c.A3798C:p.K1266N, MUC16:uc002mkp.3:exon1:c.A3798C:p.K1266N, UNKNOWN Het;T>G 2079;96|87 Het;T>G 2083;77|87 Hom;T>G 4406;0|153 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 31671209 31671209 G C snp nonsynonymous SNV G206C R69P polar,hydrophilic,charged(+) hydrophobic,neutral BPIFB4 Bpifb4 ENSG00000186191 BPI fold containing family B member 4 chr20:31667450-31699557 Antimicrobial peptides GO:0005576;extracellular region;IEA|GO:0005737;cytoplasm;IEA GO:0008289;lipid binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/BPIFB4 https://www.ncbi.nlm.nih.gov/omim/?term=615718 http://www.informatics.jax.org/searchtool/Search.do?query=BPIFB4&submit=Quick%0D%15591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=BPIFB4 rs13036385 0.215655 0.2271 0.2422 0.33 4 12 exonic exonic exonic BPIFB4 BPIFB4 ENSG00000186191 nonsynonymous SNV nonsynonymous SNV unknown BPIFB4:NM_182519:exon3:c.G206C:p.R69P, BPIFB4:uc010zue.2:exon3:c.G206C:p.R69P, UNKNOWN Het;G>C 790;51|35 Het;G>C 1227;40|53 Hom;G>C 1919;2|71 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 31671599 31671599 A G snp nonsynonymous SNV A596G D199G polar,hydrophilic,charged(-) aliphatic,neutral BPIFB4 Bpifb4 ENSG00000186191 BPI fold containing family B member 4 chr20:31667450-31699557 Antimicrobial peptides GO:0005576;extracellular region;IEA|GO:0005737;cytoplasm;IEA GO:0008289;lipid binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/BPIFB4 https://www.ncbi.nlm.nih.gov/omim/?term=615718 http://www.informatics.jax.org/searchtool/Search.do?query=BPIFB4&submit=Quick%0D%15591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=BPIFB4 rs4339026 0.233227 0.2401 0.2467 0.31 4 13 exonic exonic exonic BPIFB4 BPIFB4 ENSG00000186191 nonsynonymous SNV nonsynonymous SNV unknown BPIFB4:NM_182519:exon3:c.A596G:p.D199G, BPIFB4:uc010zue.2:exon3:c.A596G:p.D199G, UNKNOWN Het;A>G 1514;85|67 Het;A>G 1381;83|64 Hom;A>G 3059;0|108 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 31688241 31688241 T C snp nonsynonymous SNV T1579C F527L aromatic,hydrophobic,neutral aliphatic,hydrophobic,neutral BPIFB4 Bpifb4 ENSG00000186191 BPI fold containing family B member 4 chr20:31667450-31699557 Antimicrobial peptides GO:0005576;extracellular region;IEA|GO:0005737;cytoplasm;IEA GO:0008289;lipid binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/BPIFB4 https://www.ncbi.nlm.nih.gov/omim/?term=615718 http://www.informatics.jax.org/searchtool/Search.do?query=BPIFB4&submit=Quick%0D%15591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=BPIFB4 rs11699009 0.515775 0.6356 0.5666 0.23 3 13 exonic exonic exonic BPIFB4 BPIFB4 ENSG00000186191 nonsynonymous SNV nonsynonymous SNV unknown BPIFB4:NM_182519:exon12:c.T1579C:p.F527L, BPIFB4:uc010zue.2:exon12:c.T1579C:p.F527L, UNKNOWN Het;T>C 807;53|36 Het;T>C 513;49|30 Hom;T>C 1824;2|66 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 31688260 31688260 C T snp nonsynonymous SNV C1598T T533I polar,hydrophilic,neutral aliphatic,hydrophobic,neutral BPIFB4 Bpifb4 ENSG00000186191 BPI fold containing family B member 4 chr20:31667450-31699557 Antimicrobial peptides GO:0005576;extracellular region;IEA|GO:0005737;cytoplasm;IEA GO:0008289;lipid binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/BPIFB4 https://www.ncbi.nlm.nih.gov/omim/?term=615718 http://www.informatics.jax.org/searchtool/Search.do?query=BPIFB4&submit=Quick%0D%15591ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=BPIFB4 rs11696307 0.472644 0.5920 0.5539 0.23 3 13 exonic exonic exonic BPIFB4 BPIFB4 ENSG00000186191 nonsynonymous SNV nonsynonymous SNV unknown BPIFB4:NM_182519:exon12:c.C1598T:p.T533I, BPIFB4:uc010zue.2:exon12:c.C1598T:p.T533I, UNKNOWN Het;C>T 788;56|40 Het;C>T 472;66|31 Hom;C>T 1787;2|72 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 32266134 32266134 C T snp nonsynonymous SNV G598A G200S aliphatic,neutral polar,hydrophilic,neutral E2F1 E2f1 ENSG00000101412 E2F transcription factor 1 chr20:32263489-32274210 The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008] Bone Mineral Density; ovarian cancer; Lung carcinomas; epithelial ovarian cancer Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. Activation of E2F1 target genes at G1/S GO:0000077;DNA damage checkpoint;IMP|GO:0000083;regulation of transcription involved in G1/S transition of mitotic cell cycle;TAS|GO:0000122;negative regulation of transcription from RNA polymerase II promoter;IMP|GO:0006351;transcription, DNA-templated;IEA|GO:0006355;regulation of transcription, DNA-templated;IEA|GO:0006915;apoptotic process;IEA|GO:0006977;DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest;TAS|GO:0007049;cell cycle;IEA|GO:0007283;spermatogenesis;IEA|GO:0008630;intrinsic apoptotic signaling pathway in response to DNA damage;IMP|GO:0010628;positive regulation of gene expression;IDA|GO:0030900;forebrain development;IEA|GO:0043276;anoikis;IEA|GO:0043392;negative regulation of DNA binding;IDA|GO:0045599;negative regulation of fat cell differentiation;IEA|GO:0045892;negative regulation of transcription, DNA-templated;IMP|GO:0045893;positive regulation of transcription, DNA-templated;IDA|GO:0045944;positive regulation of transcription from RNA polymerase II promoter;IMP|GO:0048146;positive regulation of fibroblast proliferation;IMP|GO:0048255;mRNA stabilization;IDA|GO:0051726;regulation of cell cycle;IEA|GO:0070345;negative regulation of fat cell proliferation;IEA|GO:0071398;cellular response to fatty acid;IEA|GO:0071456;cellular response to hypoxia;IEA|GO:0071466;cellular response to xenobiotic stimulus;IEA|GO:0071930;negative regulation of transcription involved in G1/S transition of mitotic cell cycle;IMP|GO:0072332;intrinsic apoptotic signaling pathway by p53 class mediator;IEA|GO:1900740;positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway;TAS|GO:1990086;lens fiber cell apoptotic process;IEA|GO:1990090;cellular response to nerve growth factor stimulus;IEA|GO:2000045;regulation of G1/S transition of mitotic cell cycle;IMP GO:0000790;nuclear chromatin;IDA|GO:0005634;nucleus;IEA|GO:0005654;nucleoplasm;TAS|GO:0005667;transcription factor complex;IEA|GO:0005737;cytoplasm;IEA|GO:0005739;mitochondrion;IEA|GO:0005813;centrosome;IDA|GO:0035189;Rb-E2F complex;IDA GO:0001047;core promoter binding;IDA|GO:0003677;DNA binding;IDA|GO:0003700;transcription factor activity, sequence-specific DNA binding;IDA|GO:0005515;protein binding;IPI|GO:0008134;transcription factor binding;IPI|GO:0019901;protein kinase binding;IEA|GO:0043565;sequence-specific DNA binding;IEA|GO:0044212;transcription regulatory region DNA binding;IEA|GO:0046983;protein dimerization activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/E2F1 https://www.uniprot.org/uniprot/Q01094 https://www.ncbi.nlm.nih.gov/omim/?term=189971 http://www.informatics.jax.org/searchtool/Search.do?query=E2F1&submit=Quick%0D%2730ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=E2F1 rs35385772 0.0127796 0.0195 0.0228 0.00 0 13 exonic exonic exonic E2F1 E2F1 ENSG00000101412 nonsynonymous SNV nonsynonymous SNV unknown E2F1:NM_005225:exon4:c.G598A:p.G200S, E2F1:uc002wzu.4:exon4:c.G598A:p.G200S, UNKNOWN Het;C>T 1155;39|52 Het;C>T 1024;27|49 Hom;C>T 2459;0|91 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 33587198 33587198 G C snp nonsynonymous SNV G4656C K1552N polar,hydrophilic,charged(+) polar,hydrophilic,neutral MYH7B Myh7b ENSG00000078814 myosin heavy chain 7B chr20:33563206-33590240 The myosin II molecule is a multi-subunit complex consisting of two heavy chains and four light chains. This gene encodes a heavy chain of myosin II, which is a member of the motor-domain superfamily. The heavy chain includes a globular motor domain, which catalyzes ATP hydrolysis and interacts with actin, and a tail domain in which heptad repeat sequences promote dimerization by interacting to form a rod-like alpha-helical coiled coil. This heavy chain subunit is a slow-twitch myosin. Alternatively spliced transcript variants have been found, but the full-length nature of these variants is not determined. [provided by RefSeq, Mar 2010] breast cancer ; Blood Coagulation Factor Inhibitors; melanoma|Skin Neoplasms; bladder cancer; Type 2 Diabetes| edema | rosiglitazone Translocation of GLUT4 to the plasma membrane GO:0016020;membrane;IEA|GO:0016459;myosin complex;IEA|GO:0032982;myosin filament;IEA|GO:0097512;cardiac myofibril;IEA GO:0000166;nucleotide binding;IEA|GO:0003774;motor activity;IEA|GO:0003779;actin binding;IEA|GO:0005515;protein binding;IPI|GO:0005524;ATP binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/MYH7B https://www.uniprot.org/uniprot/A7E2Y1 https://www.ncbi.nlm.nih.gov/omim/?term=609928 http://www.informatics.jax.org/searchtool/Search.do?query=MYH7B&submit=Quick%0D%1678ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MYH7B rs3746435 0.171526 0.1756 0.2690 0.83 10 12 exonic exonic exonic MYH7B MYH7B ENSG00000078814 nonsynonymous SNV nonsynonymous SNV unknown MYH7B:NM_020884:exon36:c.G4656C:p.K1552N, MYH7B:uc002xbi.2:exon36:c.G4656C:p.K1552N, UNKNOWN Het;G>C 1154;59|48 Het;G>C 979;53|42 Hom;G>C 2344;0|82 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 33588698 33588720 TGAGGCTGGGCAAGGGCTGTGGG T indel splicing MYH7B Myh7b ENSG00000078814 myosin heavy chain 7B chr20:33563206-33590240 The myosin II molecule is a multi-subunit complex consisting of two heavy chains and four light chains. This gene encodes a heavy chain of myosin II, which is a member of the motor-domain superfamily. The heavy chain includes a globular motor domain, which catalyzes ATP hydrolysis and interacts with actin, and a tail domain in which heptad repeat sequences promote dimerization by interacting to form a rod-like alpha-helical coiled coil. This heavy chain subunit is a slow-twitch myosin. Alternatively spliced transcript variants have been found, but the full-length nature of these variants is not determined. [provided by RefSeq, Mar 2010] breast cancer ; Blood Coagulation Factor Inhibitors; melanoma|Skin Neoplasms; bladder cancer; Type 2 Diabetes| edema | rosiglitazone Translocation of GLUT4 to the plasma membrane GO:0016020;membrane;IEA|GO:0016459;myosin complex;IEA|GO:0032982;myosin filament;IEA|GO:0097512;cardiac myofibril;IEA GO:0000166;nucleotide binding;IEA|GO:0003774;motor activity;IEA|GO:0003779;actin binding;IEA|GO:0005515;protein binding;IPI|GO:0005524;ATP binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/MYH7B https://www.uniprot.org/uniprot/A7E2Y1 https://www.ncbi.nlm.nih.gov/omim/?term=609928 http://www.informatics.jax.org/searchtool/Search.do?query=MYH7B&submit=Quick%0D%1678ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MYH7B rs367622744 0.170927 0.1804 0.1915 1 0 0 splicing splicing splicing MYH7B MYH7B ENSG00000078814 Na Na Na Na Na Na Het;-GAGGCTGGGCAAGGGCTGTGGG 2375;97|67 Het;-GAGGCTGGGCAAGGGCTGTGGG 2062;98|57 Hom;-GAGGCTGGGCAAGGGCTGTGGG 4589;1|111 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 33703607 33703607 C T snp nonsynonymous SNV G1366A A456T aliphatic,hydrophobic,neutral polar,hydrophilic,neutral EDEM2 Edem2 ENSG00000088298 ER degradation enhancing alpha-mannosidase like protein 2 chr20:33703167-33865928 In the endoplasmic reticulum (ER), misfolded proteins are retrotranslocated to the cytosol and degraded by the proteasome in a process known as ER-associated degradation (ERAD). EDEM2 belongs to a family of proteins involved in ERAD of glycoproteins (Mast et al., 2005 [PubMed 15537790]).[supplied by OMIM, Mar 2008] Protein C ER Quality Control Compartment (ERQC) GO:0006491;N-glycan processing;IBA|GO:0006986;response to unfolded protein;IEA|GO:0030433;ubiquitin-dependent ERAD pathway;IBA|GO:0030968;endoplasmic reticulum unfolded protein response;IBA|GO:0036509;trimming of terminal mannose on B branch;TAS|GO:0036510;trimming of terminal mannose on C branch;TAS|GO:0036511;trimming of first mannose on A branch;TAS|GO:0036512;trimming of second mannose on A branch;TAS|GO:0097466;ubiquitin-dependent glycoprotein ERAD pathway;IMP|GO:1904154;positive regulation of retrograde protein transport, ER to cytosol;IGI|GO:1904382;mannose trimming involved in glycoprotein ERAD pathway;IMP GO:0005783;endoplasmic reticulum;IDA|GO:0005788;endoplasmic reticulum lumen;IEA|GO:0016020;membrane;IEA|GO:0044322;endoplasmic reticulum quality control compartment;TAS GO:0001948;glycoprotein binding;IEA|GO:0004559;alpha-mannosidase activity;TAS|GO:0004571;mannosyl-oligosaccharide 1,2-alpha-mannosidase activity;IMP|GO:0005509;calcium ion binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/EDEM2 https://www.uniprot.org/uniprot/Q9BV94 https://www.ncbi.nlm.nih.gov/omim/?term=610302 http://www.informatics.jax.org/searchtool/Search.do?query=EDEM2&submit=Quick%0D%1995ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=EDEM2 rs3746429 0.113818 0.1284 0.1585 0.08 1 13 exonic exonic exonic EDEM2 EDEM2 ENSG00000088298 nonsynonymous SNV nonsynonymous SNV unknown EDEM2:NM_001145025:exon10:c.G1255A:p.A419T,EDEM2:NM_018217:exon11:c.G1366A:p.A456T, EDEM2:uc002xbo.2:exon11:c.G1366A:p.A456T,EDEM2:uc002xbn.2:exon9:c.G910A:p.A304T,EDEM2:uc002xbq.2:exon10:c.G1255A:p.A419T,EDEM2:uc010zus.1:exon10:c.G703A:p.A235T,EDEM2:uc010zuu.1:exon9:c.G538A:p.A180T,EDEM2:uc010zut.1:exon10:c.G1243A:p.A415T, UNKNOWN Het;C>T 1433;62|64 Het;C>T 1077;46|46 Hom;C>T 2092;0|79 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34022387 34022387 A C snp nonsynonymous SNV T826G S276A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral GDF5 Gdf5 ENSG00000125965 growth differentiation factor 5 chr20:34021145-34042568 This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates the development of numerous tissue and cell types, including cartilage, joints, brown fat, teeth, and the growth of neuronal axons and dendrites. Mutations in this gene are associated with acromesomelic dysplasia, brachydactyly, chondrodysplasia, multiple synostoses syndrome, proximal symphalangism, and susceptibility to osteoarthritis. [provided by RefSeq, Aug 2016] Fractures, Bone|Osteoarthritis|Osteoarthritis, Knee; Degenerative arthropathy |Osteoarthritis; Osteoarthritis; Osteoarthritis, Hip|Osteoarthritis, Knee; Height; Hip Dislocation, Congenital; Osteoarthritis|Osteoarthritis, Hip|Osteoarthritis, Knee; height; Osteoarthritis, Knee; Body Weight|Osteoarthritis, Knee; Bone Mineral Density; osteoarthritis Homozygous mutations in this gene can cause joint patterning defects leading to complete or partial fusions between specific skeletal elements and alterations in the patterns of repeating structures in the digits, wrists and ankles. Molecules associated with elastic fibres GO:0002062;chondrocyte differentiation;IEA|GO:0007178;transmembrane receptor protein serine/threonine kinase signaling pathway;IEA|GO:0007179;transforming growth factor beta receptor signaling pathway;TAS|GO:0007184;SMAD protein import into nucleus;IDA|GO:0007267;cell-cell signaling;TAS|GO:0009612;response to mechanical stimulus;IEA|GO:0010862;positive regulation of pathway-restricted SMAD protein phosphorylation;IBA|GO:0030326;embryonic limb morphogenesis;IEA|GO:0030513;positive regulation of BMP signaling pathway;IDA|GO:0032331;negative regulation of chondrocyte differentiation;IDA|GO:0032332;positive regulation of chondrocyte differentiation;IDA|GO:0035136;forelimb morphogenesis;IEA|GO:0035137;hindlimb morphogenesis;IEA|GO:0040014;regulation of multicellular organism growth;IEA|GO:0042981;regulation of apoptotic process;IBA|GO:0043408;regulation of MAPK cascade;IBA|GO:0043524;negative regulation of neuron apoptotic process;IEA|GO:0043932;ossification involved in bone remodeling;IEA|GO:0045666;positive regulation of neuron differentiation;IEA|GO:0048468;cell development;IBA|GO:0050680;negative regulation of epithelial cell proliferation;IDA|GO:0051216;cartilage development;IEA|GO:0060395;SMAD protein signal transduction;IDA|GO:0060591;chondroblast differentiation;IDA|GO:2001054;negative regulation of mesenchymal cell apoptotic process;IEA GO:0005576;extracellular region;TAS|GO:0005615;extracellular space;IEA|GO:0005622;intracellular;IEA|GO:0005886;plasma membrane;IEA|GO:0016020;membrane;IEA GO:0005102;receptor binding;IEA|GO:0005125;cytokine activity;IEA|GO:0005160;transforming growth factor beta receptor binding;IBA|GO:0005515;protein binding;IPI|GO:0008083;growth factor activity;TAS|GO:0036122;BMP binding;IPI|GO:0042802;identical protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/GDF5 https://www.uniprot.org/uniprot/P43026 https://hpo.jax.org/app/browse/search?q=GDF5&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=601146 http://www.informatics.jax.org/searchtool/Search.do?query=GDF5&submit=Quick%0D%5887ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=GDF5 rs224331 0.383986 0.3691 0.3701 1 0 0 exonic exonic exonic GDF5 GDF5,GDF5OS ENSG00000125965,ENSG00000204183 nonsynonymous SNV nonsynonymous SNV unknown GDF5:NM_000557:exon2:c.T826G:p.S276A, GDF5:uc002xck.1:exon2:c.T826G:p.S276A,GDF5:uc010gfc.1:exon2:c.T826G:p.S276A, UNKNOWN Het;A>C 1060;38|42 Het;A>C 599;38|28 Hom;A>C 1705;0|59 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34090519 34090519 G A snp nonsynonymous SNV G2426A R809Q polar,hydrophilic,charged(+) polar,hydrophilic,neutral CEP250 Cep250 ENSG00000126001 centrosomal protein 250 chr20:34042985-34099804 This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015] Height; Chronic renal failure|Kidney Failure, Chronic; breast cancer; height; Body Height AURKA Activation by TPX2 GO:0000086;G2/M transition of mitotic cell cycle;TAS|GO:0000278;mitotic cell cycle;IDA|GO:0007049;cell cycle;IEA|GO:0008104;protein localization;IMP|GO:0010457;centriole-centriole cohesion;IMP|GO:0030997;regulation of centriole-centriole cohesion;IDA|GO:0033365;protein localization to organelle;IMP|GO:0097711;ciliary basal body docking;TAS|GO:1904781;positive regulation of protein localization to centrosome;IMP|GO:1905515;non-motile cilium assembly;IMP GO:0005737;cytoplasm;IEA|GO:0005813;centrosome;IDA|GO:0005814;centriole;IEA|GO:0005815;microtubule organizing center;NAS|GO:0005829;cytosol;TAS|GO:0005856;cytoskeleton;IEA|GO:0005929;cilium;IEA|GO:0042995;cell projection;IEA|GO:0043234;protein complex;IMP|GO:0048471;perinuclear region of cytoplasm;IEA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI|GO:0008022;protein C-terminus binding;IPI|GO:0019901;protein kinase binding;IPI|GO:0019904;protein domain specific binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/CEP250 https://www.uniprot.org/uniprot/Q9BV73 https://hpo.jax.org/app/browse/search?q=CEP250&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=609689 http://www.informatics.jax.org/searchtool/Search.do?query=CEP250&submit=Quick%0D%5899ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CEP250 rs3748433 0.138179 0.1127 0.1115 0.08 1 13 exonic exonic exonic CEP250 CEP250 ENSG00000126001 nonsynonymous SNV nonsynonymous SNV unknown CEP250:NM_007186:exon30:c.G4322A:p.R1441Q, CEP250:uc010zve.2:exon28:c.G2426A:p.R809Q,CEP250:uc021wco.1:exon30:c.G4322A:p.R1441Q, UNKNOWN Het;G>A 1870;93|80 Het;G>A 1787;55|77 Hom;G>A 3381;3|124 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34116282 34116282 T C snp nonsynonymous SNV A580G K194E polar,hydrophilic,charged(+) polar,hydrophilic,charged(-) C20orf173 6430550D23Rik ENSG00000125975 chromosome 20 open reading frame 173 chr20:34111014-34117481 GO:0009311;oligosaccharide metabolic process;IBA|GO:0018279;protein N-linked glycosylation via asparagine;IBA|GO:0097503;sialylation;IEA GO:0047288;monosialoganglioside sialyltransferase activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/C20orf173 https://www.uniprot.org/uniprot/Q96LM9 http://www.informatics.jax.org/searchtool/Search.do?query=C20orf173&submit=Quick%0D%5893ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=C20orf173 rs7261862 0.227636 0.2052 0.2366 0.08 1 12 exonic exonic exonic C20orf173 C20orf173 ENSG00000125975 nonsynonymous SNV nonsynonymous SNV unknown C20orf173:NM_001145350:exon4:c.A580G:p.K194E, C20orf173:uc010zvf.1:exon4:c.A580G:p.K194E,C20orf173:uc002xcp.2:exon3:c.A421G:p.K141E, UNKNOWN Het;T>C 1571;77|69 Het;T>C 1459;65|64 Hom;T>C 3903;2|149 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34147998 34147998 A G snp nonsynonymous SNV T307C W103R aromatic,hydrophobic,neutral polar,hydrophilic,charged(+) FER1L4 rs224424 0.39357 0 0.3910 1 0 0 ncRNA_exonic exonic ncRNA_exonic FER1L4 FER1L4 ENSG00000088340 Na nonsynonymous SNV Na Na FER1L4:uc002xcx.3:exon4:c.T307C:p.W103R, Na Het;A>G 2504;122|119 Het;A>G 2210;123|106 Hom;A>G 5167;4|199 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34152782 34152782 C T snp nonsynonymous SNV G1993A V665I aliphatic,hydrophobic,neutral aliphatic,hydrophobic,neutral FER1L4 rs2277862 0.188898 0 0.2283 1 0 0 ncRNA_exonic exonic ncRNA_exonic FER1L4 FER1L4 ENSG00000088340 Na nonsynonymous SNV Na Na FER1L4:uc010gfg.1:exon16:c.G1993A:p.V665I, Na Het;C>T 1315;46|53 Het;C>T 847;47|36 Hom;C>T 2120;0|78 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34240740 34240740 A AGGGCCG indel nonframeshift substitution 2505_2505delinsCGGCCCT RBM12 Rbm12 ENSG00000244462 RNA binding motif protein 12 chr20:34236847-34252878 This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 20q11.21. Alternative splicing in the 5' UTR results in four transcript variants. All variants encode the same protein. [provided by RefSeq, Nov 2010] Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. GO:0005634;nucleus;IEA|GO:0005654;nucleoplasm;IDA GO:0003676;nucleic acid binding;IEA|GO:0003723;RNA binding;IDA|GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/RBM12 https://www.ncbi.nlm.nih.gov/omim/?term=607179 http://www.informatics.jax.org/searchtool/Search.do?query=RBM12&submit=Quick%0D%19847ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=RBM12 rs201181145 0 0.0568 0.0560 1 0 0 exonic exonic exonic RBM12 RBM12 ENSG00000244462 nonframeshift substitution nonframeshift substitution unknown RBM12:NM_001198838:exon3:c.2505_2505delinsCGGCCCT,RBM12:NM_001198840:exon2:c.2505_2505delinsCGGCCCT,RBM12:NM_006047:exon3:c.2505_2505delinsCGGCCCT,RBM12:NM_152838:exon3:c.2505_2505delinsCGGCCCT, RBM12:uc021wcr.1:exon1:c.2505_2505delinsCGGCCCT,RBM12:uc002xdq.3:exon3:c.2505_2505delinsCGGCCCT,RBM12:uc021wcq.1:exon3:c.2505_2505delinsCGGCCCT,RBM12:uc002xds.3:exon2:c.2505_2505delinsCGGCCCT,RBM12:uc002xdr.3:exon3:c.2505_2505delinsCGGCCCT, UNKNOWN Het;+GGGCCG 2734;86|70 Het;+GGGCCG 2184;62|58 Hom;+GGGCCG 4163;0|89 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 34596371 34596371 C T snp nonsynonymous SNV C1123T P375S hydrophobic,neutral polar,hydrophilic,neutral CNBD2 Cnbd2 ENSG00000149646 cyclic nucleotide binding domain containing 2 chr20:34556512-34618622 Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. GO:0007283;spermatogenesis;IEA GO:0005737;cytoplasm;IEA|GO:0005829;cytosol;IEA GO:0000166;nucleotide binding;IEA|GO:0030552;cAMP binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/CNBD2 https://www.uniprot.org/uniprot/Q96M20 http://www.informatics.jax.org/searchtool/Search.do?query=CNBD2&submit=Quick%0D%9268ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=CNBD2 rs6060750 0.309904 0.2364 0.2429 0.38 5 13 exonic exonic exonic CNBD2 CNBD2 ENSG00000149646 nonsynonymous SNV nonsynonymous SNV unknown CNBD2:NM_001207076:exon9:c.C1123T:p.P375S,CNBD2:NM_080834:exon9:c.C1123T:p.P375S, CNBD2:uc002xer.1:exon9:c.C1123T:p.P375S,CNBD2:uc002xes.1:exon9:c.C1123T:p.P375S, UNKNOWN Het;C>T 819;29|37 Het;C>T 802;51|40 Hom;C>T 1638;2|64 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 43378770 43378770 A G snp nonsynonymous SNV A284G E95G polar,hydrophilic,charged(-) aliphatic,neutral KCNK15 Kcnk15 ENSG00000124249 potassium two pore domain channel subfamily K member 15 chr20:43374421-43379675 This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008] Phase 4 - resting membrane potential GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0061337;cardiac conduction;TAS|GO:0071805;potassium ion transmembrane transport;IEA GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005267;potassium channel activity;TAS http://www.genecards.org/index.php?path=/Search/keyword/KCNK15 https://www.uniprot.org/uniprot/Q9H427 https://www.ncbi.nlm.nih.gov/omim/?term=607368 http://www.informatics.jax.org/searchtool/Search.do?query=KCNK15&submit=Quick%0D%5633ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNK15 rs1111032 0.606829 0.5797 0.5397 0.30 3 10 exonic exonic exonic KCNK15 KCNK15 ENSG00000124249 nonsynonymous SNV nonsynonymous SNV unknown KCNK15:NM_022358:exon2:c.A284G:p.E95G, KCNK15:uc002xmr.3:exon2:c.A284G:p.E95G, UNKNOWN Het;A>G 940;72|41 Het;A>G 672;56|33 Hom;A>G 3385;0|125 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 43379264 43379264 A C snp nonsynonymous SNV A778C T260P polar,hydrophilic,neutral hydrophobic,neutral KCNK15 Kcnk15 ENSG00000124249 potassium two pore domain channel subfamily K member 15 chr20:43374421-43379675 This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008] Phase 4 - resting membrane potential GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0061337;cardiac conduction;TAS|GO:0071805;potassium ion transmembrane transport;IEA GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005267;potassium channel activity;TAS http://www.genecards.org/index.php?path=/Search/keyword/KCNK15 https://www.uniprot.org/uniprot/Q9H427 https://www.ncbi.nlm.nih.gov/omim/?term=607368 http://www.informatics.jax.org/searchtool/Search.do?query=KCNK15&submit=Quick%0D%5633ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNK15 rs6073538 0.607228 0.5371 0.5347 0.10 1 10 exonic exonic exonic KCNK15 KCNK15 ENSG00000124249 nonsynonymous SNV nonsynonymous SNV unknown KCNK15:NM_022358:exon2:c.A778C:p.T260P, KCNK15:uc002xmr.3:exon2:c.A778C:p.T260P, UNKNOWN Het;A>C 900;39|25 Het;A>C 1234;24|32 Hom;A>C 2369;0|54 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 43379268 43379268 C A snp nonsynonymous SNV C782A P261H hydrophobic,neutral aromatic,polar,hydrophilic,charged(+) KCNK15 Kcnk15 ENSG00000124249 potassium two pore domain channel subfamily K member 15 chr20:43374421-43379675 This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008] Phase 4 - resting membrane potential GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0061337;cardiac conduction;TAS|GO:0071805;potassium ion transmembrane transport;IEA GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005267;potassium channel activity;TAS http://www.genecards.org/index.php?path=/Search/keyword/KCNK15 https://www.uniprot.org/uniprot/Q9H427 https://www.ncbi.nlm.nih.gov/omim/?term=607368 http://www.informatics.jax.org/searchtool/Search.do?query=KCNK15&submit=Quick%0D%5633ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNK15 rs13037900 0.0990415 0 0.1002 0.17 2 12 exonic exonic exonic KCNK15 KCNK15 ENSG00000124249 nonsynonymous SNV nonsynonymous SNV unknown KCNK15:NM_022358:exon2:c.C782A:p.P261H, KCNK15:uc002xmr.3:exon2:c.C782A:p.P261H, UNKNOWN Het;C>A 912;37|25 Het;C>A 1234;24|32 Hom;C>A 2356;0|54 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 43379454 43379454 T C snp nonsynonymous SNV T968C L323P aliphatic,hydrophobic,neutral hydrophobic,neutral KCNK15 Kcnk15 ENSG00000124249 potassium two pore domain channel subfamily K member 15 chr20:43374421-43379675 This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008] Phase 4 - resting membrane potential GO:0006810;transport;IEA|GO:0006811;ion transport;IEA|GO:0006813;potassium ion transport;IEA|GO:0034765;regulation of ion transmembrane transport;IEA|GO:0061337;cardiac conduction;TAS|GO:0071805;potassium ion transmembrane transport;IEA GO:0005886;plasma membrane;TAS|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA GO:0005267;potassium channel activity;TAS http://www.genecards.org/index.php?path=/Search/keyword/KCNK15 https://www.uniprot.org/uniprot/Q9H427 https://www.ncbi.nlm.nih.gov/omim/?term=607368 http://www.informatics.jax.org/searchtool/Search.do?query=KCNK15&submit=Quick%0D%5633ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=KCNK15 rs13042905 0.598243 0.6000 0.5789 0.10 1 10 exonic exonic exonic KCNK15 KCNK15 ENSG00000124249 nonsynonymous SNV nonsynonymous SNV unknown KCNK15:NM_022358:exon2:c.T968C:p.L323P, KCNK15:uc002xmr.3:exon2:c.T968C:p.L323P, UNKNOWN Het;T>C 848;41|38 Het;T>C 754;53|33 Hom;T>C 1948;0|73 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 43547677 43547677 T G snp nonsynonymous SNV T634G S212A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral PABPC1L Pabpc1l ENSG00000101104 poly(A) binding protein cytoplasmic 1 like chr20:43538703-43587676 Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. GO:0001556;oocyte maturation;IEA|GO:0006338;chromatin remodeling;IEA|GO:0006378;mRNA polyadenylation;IEA|GO:0048096;chromatin-mediated maintenance of transcription;IEA|GO:0051647;nucleus localization;IEA GO:0070062;extracellular exosome;IDA GO:0003676;nucleic acid binding;IEA|GO:0003723;RNA binding;IEA http://www.genecards.org/index.php?path=/Search/keyword/PABPC1L https://www.uniprot.org/uniprot/Q4VXU2 http://www.informatics.jax.org/searchtool/Search.do?query=PABPC1L&submit=Quick%0D%2651ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PABPC1L rs2075960 0.23143 0.2218 0.2465 0.46 6 13 exonic exonic exonic PABPC1L PABPC1L ENSG00000101104 nonsynonymous SNV nonsynonymous SNV unknown PABPC1L:NM_001124756:exon4:c.T634G:p.S212A, PABPC1L:uc010ggv.1:exon4:c.T634G:p.S212A, UNKNOWN Het;T>G 3100;127|132 Het;T>G 2422;126|115 Hom;T>G 5479;2|209 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 44005936 44005936 C T snp nonsynonymous SNV G170A R57H polar,hydrophilic,charged(+) aromatic,polar,hydrophilic,charged(+) TP53TG5 Trp53tg5 ENSG00000124251 TP53 target 5 chr20:44002526-44036529 GO:0030308;negative regulation of cell growth;NAS|GO:0035556;intracellular signal transduction;NAS GO:0005634;nucleus;IDA|GO:0005737;cytoplasm;IEA GO:0003674;molecular_function;ND http://www.genecards.org/index.php?path=/Search/keyword/TP53TG5 https://www.uniprot.org/uniprot/Q9Y2B4 https://www.ncbi.nlm.nih.gov/omim/?term=617316 http://www.informatics.jax.org/searchtool/Search.do?query=TP53TG5&submit=Quick%0D%5634ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TP53TG5 rs2231616 0.201278 0.1193 0.1801 0.08 1 13 exonic exonic exonic TP53TG5 TP53TG5 ENSG00000124251 nonsynonymous SNV nonsynonymous SNV unknown TP53TG5:NM_014477:exon3:c.G170A:p.R57H, TP53TG5:uc002xny.3:exon3:c.G170A:p.R57H, UNKNOWN Het;C>T 718;67|40 Het;C>T 881;50|44 Hom;C>T 2114;2|83 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 44184498 44184498 A G snp nonsynonymous SNV T287C M96T hydrophobic,neutral polar,hydrophilic,neutral WFDC8 Wfdc8 ENSG00000158901 WAP four-disulfide core domain 8 chr20:44179792-44207965 This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008] GO:0010466;negative regulation of peptidase activity;IEA|GO:0010951;negative regulation of endopeptidase activity;IEA GO:0005576;extracellular region;IEA GO:0004867;serine-type endopeptidase inhibitor activity;IEA|GO:0030414;peptidase inhibitor activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/WFDC8 http://www.informatics.jax.org/searchtool/Search.do?query=WFDC8&submit=Quick%0D%10270ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=WFDC8 rs2272955 0.103435 0.0940 0.0736 0.15 2 13 exonic exonic exonic WFDC8 WFDC8 ENSG00000158901 nonsynonymous SNV nonsynonymous SNV unknown WFDC8:NM_181510:exon4:c.T287C:p.M96T,WFDC8:NM_130896:exon4:c.T287C:p.M96T, WFDC8:uc002xox.3:exon4:c.T287C:p.M96T,WFDC8:uc002xow.3:exon4:c.T287C:p.M96T, UNKNOWN Het;A>G 800;44|36 Het;A>G 660;42|31 Hom;A>G 1322;0|50 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 44238741 44238741 T G snp nonsynonymous SNV A80C N27T polar,hydrophilic,neutral polar,hydrophilic,neutral WFDC9 Wfdc9 ENSG00000180205 WAP four-disulfide core domain 9 chr20:44236578-44259907 The WAP-type four-disulfide core (WFDC) domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many members of the WFDC domain family. This gene encodes a protein which contains a WFDC domain, and is thus a member of the WFDC domain family. This gene and several other gene family members are clustered at 20q13.12. [provided by RefSeq, Jul 2008] Cholesterol, LDL; Mental Competency GO:0005576;extracellular region;IEA http://www.genecards.org/index.php?path=/Search/keyword/WFDC9 http://www.informatics.jax.org/searchtool/Search.do?query=WFDC9&submit=Quick%0D%14444ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=WFDC9 rs2245898 0.393371 0.3505 0.3539 0.08 1 12 exonic exonic exonic WFDC9 WFDC9 ENSG00000180205 nonsynonymous SNV nonsynonymous SNV unknown WFDC9:NM_147198:exon3:c.A80C:p.N27T, WFDC9:uc002xoy.3:exon3:c.A80C:p.N27T, UNKNOWN Het;T>G 946;44|44 Het;T>G 943;44|41 Hom;T>G 2219;0|83 20_50.701_78.701 Chr20:25016495-51804476 1.1 20 45169957 45169957 C T snp nonsynonymous SNV G1657A V553M aliphatic,hydrophobic,neutral hydrophobic,neutral OCSTAMP Ocstamp ENSG00000149635 osteoclast stimulatory transmembrane protein chr20:45169585-45179213 Mice homozygous for a knock-out allele exhibit defective osteoclast fusion but normal skeletal paramaters. GO:0030154;cell differentiation;IEA|GO:0034241;positive regulation of macrophage fusion;IEA|GO:0045672;positive regulation of osteoclast differentiation;IEA|GO:0071356;cellular response to tumor necrosis factor;IEA|GO:0071391;cellular response to estrogen stimulus;IEA|GO:0072674;multinuclear osteoclast differentiation;IEA|GO:0090290;positive regulation of osteoclast proliferation;IEA GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA http://www.genecards.org/index.php?path=/Search/keyword/OCSTAMP https://www.uniprot.org/uniprot/Q9BR26 http://www.informatics.jax.org/searchtool/Search.do?query=OCSTAMP&submit=Quick%0D%9265ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=OCSTAMP rs41283036 0.00479233 0.0039 0.0092 0.00 0 12 exonic exonic exonic OCSTAMP OCSTAMP ENSG00000149635 nonsynonymous SNV nonsynonymous SNV unknown OCSTAMP:NM_080721:exon3:c.G1657A:p.V553M, OCSTAMP:uc010zxu.2:exon3:c.G1657A:p.V553M, UNKNOWN Het;C>T 816;29|34 Het;C>T 607;41|30 Hom;C>T 1696;0|64 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50582575 50582575 A G snp nonsynonymous SNV A2408G N803S polar,hydrophilic,neutral polar,hydrophilic,neutral MOV10L1 Mov10l1 ENSG00000073146 Mov10 RISC complex RNA helicase like 1 chr22:50528308-50600119 This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009] Tobacco Use Disorder Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. PIWI-interacting RNA (piRNA) biogenesis GO:0007141;male meiosis I;ISS|GO:0007275;multicellular organism development;IEA|GO:0007281;germ cell development;IEP|GO:0007283;spermatogenesis;IEP|GO:0034587;piRNA metabolic process;ISS|GO:0043046;DNA methylation involved in gamete generation;ISS|GO:0007141;male meiosis I;ISS|GO:0007275;multicellular organism development;IEA|GO:0007281;germ cell development;IEP|GO:0007283;spermatogenesis;IEP|GO:0034587;piRNA metabolic process;ISS|GO:0043046;DNA methylation involved in gamete generation;ISS GO:0005622;intracellular;IC|GO:0005737;cytoplasm;IEA|GO:0043186;P granule;ISS|GO:0071546;pi-body;ISS GO:0000166;nucleotide binding;IEA|GO:0000287;magnesium ion binding;TAS|GO:0003723;RNA binding;TAS|GO:0004004;ATP-dependent RNA helicase activity;ISS|GO:0004386;helicase activity;IEA|GO:0005524;ATP binding;IEA|GO:0016787;hydrolase activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/MOV10L1 https://www.uniprot.org/uniprot/Q9BXT6 https://www.ncbi.nlm.nih.gov/omim/?term=605794 http://www.informatics.jax.org/searchtool/Search.do?query=MOV10L1&submit=Quick%0D%26ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=MOV10L1 rs143335661 0 7.7e-05 7.414e-05 0.92 12 13 exonic exonic exonic MOV10L1 MOV10L1 ENSG00000073146 nonsynonymous SNV nonsynonymous SNV unknown MOV10L1:NM_018995:exon18:c.A2408G:p.N803S,MOV10L1:NM_001164104:exon18:c.A2408G:p.N803S,MOV10L1:NM_001164105:exon18:c.A2348G:p.N783S, MOV10L1:uc003bjj.3:exon18:c.A2408G:p.N803S,MOV10L1:uc003bjk.4:exon18:c.A2408G:p.N803S,MOV10L1:uc011arp.2:exon18:c.A2348G:p.N783S, UNKNOWN Het;A>G 1297;64|60 Het;A>G 1279;67|58 Hom;A>G 2620;0|93 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50646936 50646936 G C snp nonsynonymous SNV G163C A55P aliphatic,hydrophobic,neutral hydrophobic,neutral SELO Selo rs5771102 0.701877 0.6697 0.6200 1 0 0 intronic exonic ncRNA_exonic SELO SELO ENSG00000273137 Na nonsynonymous SNV Na Na SELO:uc010hap.3:exon2:c.G163C:p.A55P, Na Het;G>C 436;21|19 Het;G>C 730;17|33 Hom;G>C 1102;0|35 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50658424 50658424 T C snp nonsynonymous SNV A4105G T1369A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral TUBGCP6 Tubgcp6 ENSG00000128159 tubulin gamma complex associated protein 6 chr22:50656118-50683421 The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008] HIV Infections|[X]Human immunodeficiency virus disease; Erythrocyte Count Recruitment of NuMA to mitotic centrosomes GO:0000226;microtubule cytoskeleton organization;IEA|GO:0007020;microtubule nucleation;IDA|GO:0031122;cytoplasmic microtubule organization;IBA|GO:0051298;centrosome duplication;IBA|GO:0051415;interphase microtubule nucleation by interphase microtubule organizing center;IBA|GO:0090307;mitotic spindle assembly;IBA GO:0000922;spindle pole;IEA|GO:0000923;equatorial microtubule organizing center;IBA|GO:0005737;cytoplasm;IEA|GO:0005813;centrosome;IDA|GO:0005815;microtubule organizing center;IEA|GO:0005829;cytosol;TAS|GO:0005856;cytoskeleton;IEA|GO:0005874;microtubule;IEA|GO:0008274;gamma-tubulin ring complex;IDA|GO:0016020;membrane;IDA|GO:0070062;extracellular exosome;IDA GO:0005200;structural constituent of cytoskeleton;IBA|GO:0008017;microtubule binding;IDA|GO:0043015;gamma-tubulin binding;IBA|GO:0051011;microtubule minus-end binding;IBA http://www.genecards.org/index.php?path=/Search/keyword/TUBGCP6 https://www.uniprot.org/uniprot/Q96RT7 https://hpo.jax.org/app/browse/search?q=TUBGCP6&navFilter=all https://www.ncbi.nlm.nih.gov/omim/?term=610053 http://www.informatics.jax.org/searchtool/Search.do?query=TUBGCP6&submit=Quick%0D%6102ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=TUBGCP6 rs11703226 0.427117 0.4577 0.4319 0.08 1 13 exonic exonic exonic TUBGCP6 TUBGCP6 ENSG00000128159 nonsynonymous SNV nonsynonymous SNV unknown TUBGCP6:NM_020461:exon17:c.A4129G:p.T1377A, TUBGCP6:uc010har.1:exon17:c.A4105G:p.T1369A,TUBGCP6:uc003bka.1:exon2:c.A1390G:p.T464A,TUBGCP6:uc003bkb.1:exon17:c.A4129G:p.T1377A, UNKNOWN Het;T>C 904;65|44 Het;T>C 937;32|41 Hom;T>C 2088;3|82 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50722167 50722167 T C snp nonsynonymous SNV A2434G T812A polar,hydrophilic,neutral aliphatic,hydrophobic,neutral PLXNB2 Plxnb2 ENSG00000196576 plexin B2 chr22:50713408-50746056 Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008] Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. GO:0001843;neural tube closure;IEA|GO:0001932;regulation of protein phosphorylation;IEA|GO:0007156;homophilic cell adhesion via plasma membrane adhesion molecules;IDA|GO:0007162;negative regulation of cell adhesion;IBA|GO:0007165;signal transduction;IEA|GO:0007275;multicellular organism development;IEA|GO:0007405;neuroblast proliferation;IEA|GO:0007420;brain development;IEA|GO:0008360;regulation of cell shape;IEA|GO:0010976;positive regulation of neuron projection development;IDA|GO:0043087;regulation of GTPase activity;IEA|GO:0050772;positive regulation of axonogenesis;IEA|GO:0071526;semaphorin-plexin signaling pathway;IEA|GO:2001222;regulation of neuron migration;IEA GO:0005886;plasma membrane;IEA|GO:0005887;integral component of plasma membrane;IEA|GO:0009986;cell surface;IDA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI|GO:0017154;semaphorin receptor activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PLXNB2 https://www.ncbi.nlm.nih.gov/omim/?term=604293 http://www.informatics.jax.org/searchtool/Search.do?query=PLXNB2&submit=Quick%0D%16406ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PLXNB2 rs28470336 0.01877 0.0401 0.0396 0.23 3 13 exonic exonic exonic PLXNB2 PLXNB2 ENSG00000196576 nonsynonymous SNV nonsynonymous SNV unknown PLXNB2:NM_012401:exon15:c.A2434G:p.T812A, PLXNB2:uc003bkv.4:exon15:c.A2434G:p.T812A, UNKNOWN Het;T>C 2598;140|119 Het;T>C 2788;115|124 Hom;T>C 5229;1|190 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50728062 50728062 T C snp nonsynonymous SNV A952G K318E polar,hydrophilic,charged(+) polar,hydrophilic,charged(-) PLXNB2 Plxnb2 ENSG00000196576 plexin B2 chr22:50713408-50746056 Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008] Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. GO:0001843;neural tube closure;IEA|GO:0001932;regulation of protein phosphorylation;IEA|GO:0007156;homophilic cell adhesion via plasma membrane adhesion molecules;IDA|GO:0007162;negative regulation of cell adhesion;IBA|GO:0007165;signal transduction;IEA|GO:0007275;multicellular organism development;IEA|GO:0007405;neuroblast proliferation;IEA|GO:0007420;brain development;IEA|GO:0008360;regulation of cell shape;IEA|GO:0010976;positive regulation of neuron projection development;IDA|GO:0043087;regulation of GTPase activity;IEA|GO:0050772;positive regulation of axonogenesis;IEA|GO:0071526;semaphorin-plexin signaling pathway;IEA|GO:2001222;regulation of neuron migration;IEA GO:0005886;plasma membrane;IEA|GO:0005887;integral component of plasma membrane;IEA|GO:0009986;cell surface;IDA|GO:0016020;membrane;IEA|GO:0016021;integral component of membrane;IEA|GO:0070062;extracellular exosome;IDA GO:0005515;protein binding;IPI|GO:0017154;semaphorin receptor activity;IEA http://www.genecards.org/index.php?path=/Search/keyword/PLXNB2 https://www.ncbi.nlm.nih.gov/omim/?term=604293 http://www.informatics.jax.org/searchtool/Search.do?query=PLXNB2&submit=Quick%0D%16406ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PLXNB2 rs28379706 0.454073 0.4520 0.3817 0.08 1 13 exonic exonic exonic PLXNB2 PLXNB2 ENSG00000196576 nonsynonymous SNV nonsynonymous SNV unknown PLXNB2:NM_012401:exon3:c.A952G:p.K318E, PLXNB2:uc003bkv.4:exon3:c.A952G:p.K318E, UNKNOWN Het;T>C 2079;107|95 Het;T>C 1723;81|81 Hom;T>C 3854;0|142 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50878196 50878196 G A snp nonsynonymous SNV G2195A R732K polar,hydrophilic,charged(+) polar,hydrophilic,charged(+) PPP6R2 Ppp6r2 ENSG00000100239 protein phosphatase 6 regulatory subunit 2 chr22:50781733-50883514 Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010] GO:0005737;cytoplasm;IEA|GO:0005829;cytosol;IDA|GO:0043231;intracellular membrane-bounded organelle;IDA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/PPP6R2 https://www.uniprot.org/uniprot/O75170 https://www.ncbi.nlm.nih.gov/omim/?term=610877 http://www.informatics.jax.org/searchtool/Search.do?query=PPP6R2&submit=Quick%0D%2444ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PPP6R2 rs13057311 0.19369 0.2304 0.2447 0.15 2 13 exonic exonic exonic PPP6R2 PPP6R2 ENSG00000100239 nonsynonymous SNV nonsynonymous SNV unknown PPP6R2:NM_001242900:exon19:c.G2117A:p.R706K,PPP6R2:NM_001242898:exon20:c.G2195A:p.R732K,PPP6R2:NM_014678:exon19:c.G2114A:p.R705K,PPP6R2:NM_001242899:exon19:c.G2117A:p.R706K, PPP6R2:uc003blc.3:exon20:c.G2195A:p.R732K,PPP6R2:uc003blb.2:exon21:c.G2195A:p.R732K,PPP6R2:uc003bkz.2:exon19:c.G2114A:p.R705K,PPP6R2:uc003bld.2:exon9:c.G794A:p.R265K,PPP6R2:uc003bky.2:exon19:c.G2117A:p.R706K,PPP6R2:uc003bla.2:exon19:c.G2117A:p.R706K, UNKNOWN Het;G>A 1658;77|72 Het;G>A 1623;52|75 Hom;G>A 3382;0|124 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50942121 50942121 C T snp nonsynonymous SNV G1748A S583N polar,hydrophilic,neutral polar,hydrophilic,neutral LMF2 Lmf2 ENSG00000100258 lipase maturation factor 2 chr22:50941376-50946135 Assembly of active LPL and LIPC lipase complexes GO:0005783;endoplasmic reticulum;IEA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0016020;membrane;IDA|GO:0016021;integral component of membrane;IEA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/LMF2 https://www.uniprot.org/uniprot/Q9BU23 http://www.informatics.jax.org/searchtool/Search.do?query=LMF2&submit=Quick%0D%2451ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=LMF2 rs13056405 0.138578 0.1957 0.1908 0.15 2 13 exonic exonic exonic LMF2 LMF2 ENSG00000100258 nonsynonymous SNV nonsynonymous SNV unknown LMF2:NM_033200:exon14:c.G1823A:p.S608N, LMF2:uc003blo.2:exon14:c.G1748A:p.S583N,LMF2:uc003blp.2:exon14:c.G1823A:p.S608N, UNKNOWN Het;C>T 571;28|25 Het;C>T 429;20|20 Hom;C>T 997;2|34 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50943232 50943232 G A snp nonsynonymous SNV C1361T T454M polar,hydrophilic,neutral hydrophobic,neutral LMF2 Lmf2 ENSG00000100258 lipase maturation factor 2 chr22:50941376-50946135 Assembly of active LPL and LIPC lipase complexes GO:0005783;endoplasmic reticulum;IEA|GO:0005789;endoplasmic reticulum membrane;IEA|GO:0016020;membrane;IDA|GO:0016021;integral component of membrane;IEA GO:0005515;protein binding;IPI http://www.genecards.org/index.php?path=/Search/keyword/LMF2 https://www.uniprot.org/uniprot/Q9BU23 http://www.informatics.jax.org/searchtool/Search.do?query=LMF2&submit=Quick%0D%2451ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=LMF2 rs8136495 0.141973 0.2052 0.1853 0.23 3 13 exonic exonic exonic LMF2 LMF2 ENSG00000100258 nonsynonymous SNV nonsynonymous SNV unknown LMF2:NM_033200:exon10:c.C1436T:p.T479M, LMF2:uc003blo.2:exon10:c.C1361T:p.T454M,LMF2:uc003blp.2:exon10:c.C1436T:p.T479M, UNKNOWN Het;G>A 1314;73|62 Het;G>A 1321;51|63 Hom;G>A 2828;0|108 22_57.194_74.694 Chr22:45430165-51215481 0.519 22 50969647 50969647 C G snp nonsynonymous SNV G320C G107A aliphatic,neutral aliphatic,hydrophobic,neutral ODF3B Odf3b ENSG00000177989 outer dense fiber of sperm tails 3B chr22:50968139-50971009 Multiple Sclerosis; Erythrocyte Indices; Type 2 Diabetes| edema | rosiglitazone http://www.genecards.org/index.php?path=/Search/keyword/ODF3B http://www.informatics.jax.org/searchtool/Search.do?query=ODF3B&submit=Quick%0D%14115ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=ODF3B rs139023197 0.0201677 0.0280 0.0326 0.42 5 12 exonic exonic exonic ODF3B ODF3B ENSG00000177989 nonsynonymous SNV nonsynonymous SNV unknown ODF3B:NM_001014440:exon4:c.G391C:p.G131R, ODF3B:uc003bmg.2:exon3:c.G320C:p.G107A,ODF3B:uc003bmh.2:exon4:c.G391C:p.G131R, UNKNOWN Het;C>G 1294;53|59 Het;C>G 1367;47|64 Hom;C>G 3489;0|127 4_17.387_23.387 Chr4:7152608-8704080 0.68 4 7435058 7435058 C T snp nonsynonymous SNV G1549A A517T aliphatic,hydrophobic,neutral polar,hydrophilic,neutral PSAPL1 Psapl1 ENSG00000178597 prosaposin-like 1 (gene/pseudogene) chr4:7432022-7436700 This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015] GO:0006629;lipid metabolic process;IEA|GO:0006665;sphingolipid metabolic process;IEA|GO:0007193;adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway;IBA|GO:0019216;regulation of lipid metabolic process;IBA|GO:0043085;positive regulation of catalytic activity;IEA|GO:0060736;prostate gland growth;IBA|GO:0060742;epithelial cell differentiation involved in prostate gland development;IBA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IBA|GO:0005737;cytoplasm;IBA|GO:0005764;lysosome;IEA|GO:0005829;cytosol;IDA GO:0001664;G-protein coupled receptor binding;IBA|GO:0008047;enzyme activator activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/PSAPL1 http://www.informatics.jax.org/searchtool/Search.do?query=PSAPL1&submit=Quick%0D%14205ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PSAPL1 rs60816800 0.103035 0.1316 0.1869 0.08 1 12 exonic exonic exonic PSAPL1 PSAPL1 ENSG00000178597 nonsynonymous SNV nonsynonymous SNV unknown PSAPL1:NM_001085382:exon1:c.G1549A:p.A517T, PSAPL1:uc011bwj.2:exon1:c.G1549A:p.A517T, UNKNOWN Het;C>T 1349;42|55 Ref Hom;C>T 1436;2|54 4_17.387_23.387 Chr4:7152608-8704080 0.68 4 7435486 7435486 G T snp nonsynonymous SNV C1121A A374E aliphatic,hydrophobic,neutral polar,hydrophilic,charged(-) PSAPL1 Psapl1 ENSG00000178597 prosaposin-like 1 (gene/pseudogene) chr4:7432022-7436700 This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015] GO:0006629;lipid metabolic process;IEA|GO:0006665;sphingolipid metabolic process;IEA|GO:0007193;adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway;IBA|GO:0019216;regulation of lipid metabolic process;IBA|GO:0043085;positive regulation of catalytic activity;IEA|GO:0060736;prostate gland growth;IBA|GO:0060742;epithelial cell differentiation involved in prostate gland development;IBA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IBA|GO:0005737;cytoplasm;IBA|GO:0005764;lysosome;IEA|GO:0005829;cytosol;IDA GO:0001664;G-protein coupled receptor binding;IBA|GO:0008047;enzyme activator activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/PSAPL1 http://www.informatics.jax.org/searchtool/Search.do?query=PSAPL1&submit=Quick%0D%14205ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PSAPL1 rs61738677 0.0766773 0.1003 0.1107 0.08 1 13 exonic exonic exonic PSAPL1 PSAPL1 ENSG00000178597 nonsynonymous SNV nonsynonymous SNV unknown PSAPL1:NM_001085382:exon1:c.C1121A:p.A374E, PSAPL1:uc011bwj.2:exon1:c.C1121A:p.A374E, UNKNOWN Het;G>T 2835;128|119 Ref Hom;G>T 6911;0|249 4_17.387_23.387 Chr4:7152608-8704080 0.68 4 7435721 7435721 C T snp nonsynonymous SNV G886A V296M aliphatic,hydrophobic,neutral hydrophobic,neutral PSAPL1 Psapl1 ENSG00000178597 prosaposin-like 1 (gene/pseudogene) chr4:7432022-7436700 This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015] GO:0006629;lipid metabolic process;IEA|GO:0006665;sphingolipid metabolic process;IEA|GO:0007193;adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway;IBA|GO:0019216;regulation of lipid metabolic process;IBA|GO:0043085;positive regulation of catalytic activity;IEA|GO:0060736;prostate gland growth;IBA|GO:0060742;epithelial cell differentiation involved in prostate gland development;IBA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IBA|GO:0005737;cytoplasm;IBA|GO:0005764;lysosome;IEA|GO:0005829;cytosol;IDA GO:0001664;G-protein coupled receptor binding;IBA|GO:0008047;enzyme activator activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/PSAPL1 http://www.informatics.jax.org/searchtool/Search.do?query=PSAPL1&submit=Quick%0D%14205ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PSAPL1 rs6850206 0.129193 0.1716 0.1673 0.46 6 13 exonic exonic exonic PSAPL1 PSAPL1 ENSG00000178597 nonsynonymous SNV nonsynonymous SNV unknown PSAPL1:NM_001085382:exon1:c.G886A:p.V296M, PSAPL1:uc011bwj.2:exon1:c.G886A:p.V296M, UNKNOWN Het;C>T 3608;150|155 Ref Hom;C>T 5924;2|218 4_17.387_23.387 Chr4:7152608-8704080 0.68 4 7436239 7436239 C T snp nonsynonymous SNV G368A R123H polar,hydrophilic,charged(+) aromatic,polar,hydrophilic,charged(+) PSAPL1 Psapl1 ENSG00000178597 prosaposin-like 1 (gene/pseudogene) chr4:7432022-7436700 This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015] GO:0006629;lipid metabolic process;IEA|GO:0006665;sphingolipid metabolic process;IEA|GO:0007193;adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway;IBA|GO:0019216;regulation of lipid metabolic process;IBA|GO:0043085;positive regulation of catalytic activity;IEA|GO:0060736;prostate gland growth;IBA|GO:0060742;epithelial cell differentiation involved in prostate gland development;IBA GO:0005576;extracellular region;IEA|GO:0005615;extracellular space;IBA|GO:0005737;cytoplasm;IBA|GO:0005764;lysosome;IEA|GO:0005829;cytosol;IDA GO:0001664;G-protein coupled receptor binding;IBA|GO:0008047;enzyme activator activity;IBA http://www.genecards.org/index.php?path=/Search/keyword/PSAPL1 http://www.informatics.jax.org/searchtool/Search.do?query=PSAPL1&submit=Quick%0D%14205ASearch https://www.ncbi.nlm.nih.gov/pubmed/?term=PSAPL1 rs56402179 0.103435 0.1397 0.1620 0.17 2 12 exonic exonic exonic PSAPL1 PSAPL1 ENSG00000178597 nonsynonymous SNV nonsynonymous SNV unknown PSAPL1:NM_001085382:exon1:c.G368A:p.R123H, PSAPL1:uc011bwj.2:exon1:c.G368A:p.R123H, UNKNOWN Het;C>T 2014;76|87 Ref Hom;C>T 4443;0|160